Description :
From Genome Similarity Track
Location :
Scaffold_1123:260- 4699
Sequence
4439 bases(100 bases per row)
TTTGGTCCTTGTATTTGTCCTTAATCCGGGGCCAGTTGGGGATAAAGGTAACGGAGTTACATGGAATAGTGACCTTGTCACTATTCCGGGATGGCTACAT
CGGTCACTCCCCTGAATAGTGACCCAAGTGGCCTCAGAGCCAACAGATACATTTTGTATGACACAAACTATAGGGAACTTAGGATTTGTATGCAGGCCAA
ATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGCACGACTGTTCACTTGG
AGTTTGTATACTCCTGCTTCCTATGTTAAGAAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGGGGTCAATCCTACGCCTACGCGGGTAGATTGGAC
TACCTGAATCATGTGTGGTCCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCCCCATCTGATCGACTCGCAGTACGAGTCCGTTCGTAAGATGACAG
GCATCTTTGGGACAGATGCCCTGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGCGGGCTCAT
CGCCCACGTTCAAGGGCTGCAGGCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCTTTCGAAGGGAAGGAAGGA
GAAAACCTTCACTTCTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTA
GTGGTCGCGCTAAGAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCT
TCCGGCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCTCT
GTCTCTTTGGTGGGGAACCCCCTGCCTGAACACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAGCTGTTCCGTGTGC
AAGCAAACACTATGGAGGAGGCGATTCAGATCGCCCTCCAGGAAGAGTACAGTCACAAGCAGGCTCGTACCCCCGCCACGGTATGTCAGAGCAACCCTGT
CTCTGGCGGTGCGCCTAATGGTAACTCCGGCAATGGAGCGATCAACCGGCCGGTTCCCATGAATCTGGGCATGGCCGAGCAGAGCGACATTCGTTGCTAC
GGCTGTGGCAAGCTTGGGCACATGAAACGTGCTTGTCCCGCGGAAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGA
AGCCGCGCCCCAGGAACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGCA
CGCCATGGGGACTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATC
ATCCCTTGAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGCGACAAGTGCGCCGATGCGCTACGAGG
CAGCAAAGGCAACGGGCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGTCAAGTTCGAGGACTTC
GACAGCACGGAGCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGTATGCCGTGGCTGGAGAAACATGAGCCTTGGATCGACCGGCGCG
GCAAGGCCATCGGGGCCAGCCGTCCCCCACGCTCTGACAGAGCTTTGATGAGTCATGTTCCCACCTCTGGCAGCAGCTGGGGCACCCGCGAGGGCCCCCA
GGGCGCAGCAGCGTCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACC
TACCAGGTGGGTAACGTAGGTCCACACGCGGGTAACGAAGTACCGCAGACAGCAAGAGCTGCTGGAGAAAGCGCCGCTGGCGTTGGCGTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCAAGGACAAGGCGGGTAACGTA
GTTCTGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCCGCGCCTCGAGACGAAGACACCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGTGTGGC
CGACGACGCTAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCGTGACCGGTCGTCGGGTCAA
GACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAACCTTGAGGAGCTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGGCCGGG
GAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGGCATGGACCAGGCAGTCCTAGAGGAGTTCCAGAGAC
AGCGTGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGACCCGGTGTACCCCTTGGTGAAGGAGTTTGAGGACGTGGTGTCCAAGGATCCACC
GTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCTTGCCGGGCACGAAGTACTGTGTCACGAGGCAATGGCCTCTTCCCCGGGAGCAG
TGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAAC
CGAACGGAAAGTGGTGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACGGTGCCTGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAA
CATGGTCGGCTGCACGCTGTATAGCGCGCTGGACCTGGTGGACGGTTACTACCAGATCCTGATGCGCGAGAGCGACATCCCACTTACGGCTGTGAGCACG
CCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACACAACTGTTCCAACCTTTGC
GTGCGTTCACACAGACGTACTTTGACGACATCTTCGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAGCACCTTCGACGTGT
GTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCAGCTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCAGCAGCGCC
GGGGTCCGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTACGACAGTGGTTGGGCCTCGCCAACTACC
TGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGGGAGCGTCGCCATCAAGATGC
TTTTAACGACATCAAAGCGAGCTTACAGCGCGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCCTTTCAGCGTAGTCTGTGATGCGTCTGACTACGCA
ATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCATCTCGTTCCAGTCCAGGCAGCTCAAGGCATCCCAACGGAACTATCCAGTCC
ACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTCCACCTCCTGGGCTCGACGCCCTTTGTCGTTTATACAGACCACGCGTCCTT
GCGGACTGCCGTCAACACGCCGCATCTCTCACAGCGGATGGCGCGTTGGTTGTCATTCTTCACGGAATACAACTTCCGTGTCGAGGACAAGCCGGGCAAG
TTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACGACGGATCTGTATGAACGCATCAGGCTGGGGT
ACCGAGACGATGCCAGTCTCGGACCTCTTGTGCGGTTCTTGACCGCTGGCTCGGAAGCCAATGCCGAGTGGCTCACGCCCCGACAACGTGCAAGGCTGCA
CCGCTATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGTGCCCAACGACGAGGATCTCAAGTACGACATC
CTGATGGAGGCGCACGACGCTCCATCCAGTGGCCATCTC