Description :
From Genome Similarity Track
Location :
Scaffold_3020:260- 2410
Transcript NameFunction/comments
Phyta_totarag15011hypothetical protein

Sequence
2150 bases(100 bases per row)
CCCACGTCATGAAGCTCACCACACCCACGGCACACCAAAAGGCAGTGATCCGCCGGATGGCCCTGCTTGCCACACTTCTGGCACGGTAGACGCCTCCAGC
AGCCCAGATCCGTGTGCTTGCGAGATCTACAATGGGTACAGCGGTTGCGATCGGGTCCGTCAGCCTGGTACCTGGATCTGTGATCTCGAGGCGATTGATC
GGGAGGacgtcgatcttcttggcttcGGTCCGCATGGATCGAGTCTCCCTCGGCTGCTGGCTGGTTTTCATTGCTTGCCGCGAGGTAGATCCGGTGATAG
TCGCCCTCATCAGAGTCGGATCCGTCGTTCGATCCGGGGTCGGATCCCGATTCCGGAGCTTGGGCTTGAATCGCACGGACATGTTTGGCGGGGCTGCGGG
AGCCGGAGTCGGTGCCTTCTGCCTATACTTGCTGGATCCCAGCGCCGACTGCTTCTGGCGACTCTTGGCACGCTCAAGTGCGCGAAGGACCTCTTCCCGC
TCGTCAGCATCCGGCAGTCGCAACAATATCAGCCGATCTGCCAGCTCTTGATCTCCCAATGTCTCGAGGAAGTGATCGACATGCTCACGTCGATCCTTCG
GTCCAccgtccttgatcttcagTCGTGCTCGCAATCCTGCAACGTTAANTCGGAGGCTTGATCACGCAAGAATGCGGACTTAACCTTGCTGATCCACCCT
CTTGCCCGATCTTCGTCTTGATCGTTTCCGGTGAACTCCTTCAGATCCGAGATTGCTGCGATCCGCACACGTTGGATTAGCGCGGATCCAGCTGATCCGG
CCGTTGCTATGGCCACTGCGGTACGAGTGAGTGAGTCATCCAGATCGTCGGGGTCGTATTCTTAGAGAGCGGGGTGGTTATCCGACCGACTCCATGTCCA
CATCTTGCGCGCCAACGTTCCTTGTCGTGACTGCGACCGGGGTCGGTGCCGTGATCTGCTGTTCTTTGATGAATCGGCTCATAGCAGCTTGGAAGTACGA
TTCCAGTCTGCCTGTTGATCCGTCTGGCGAAGTTACGTTCGTGATCTGACTTGGCTGTCGCGGCTGCATCCGATCCGGGGATGTCCCACGAGATCGATAT
CTCAATAGTTCTTCTCCGGAAGGTCCGAGAGGCATACGTTGCGGCCCTAGAGATCCATCTGAATCAGGTTCTGATGTGACCGATGCGTAATGTGAAGAGC
TAGTCTGGTACTCCGTCGTGCTGATCCGGGGCGAGATCTCTGGATCTTCAATCCGTCCATTTCCACCTACCAAGACCACTAGTCTAGCGAAAAGCTCTTG
GAAGTAGATTTGACGGTATCTAGATCCAGATCGAACAGTCTGTCAGCGTCGAAAGCGCCGGCAACTAGACCTCCCTCTTTTAGCATTTGAAGTAGGTTCT
TCACCGCAGCCAGCTTGTTGGACGTCTCCGTCGGAGCTGACACTGGTCCCTTTAGATTTCCGATCTGCTCTAActtcatgatcttcatcGTTGGATCTTG
GAGTAAGAACTTGCGTAGTGCCTCGTGGCGAAACGCAAACTCCAGATCCTGCTCAATCCAACTCGATGGCGATTCCTCTGATCTTCGCCTTCCGACTCAG
GGGCCTTAATTTTCTTCCGCGTAGCCTtcaatttcttcttcttcgttctAGATGTTGGGACTAGCAGGCTTGTGGTCACTTCTTCCGTCGCGAACACATA
CGGATCGGGTTTTCCCTTACCGATTTGCGTTGCGGTTCTCGATGCGTATCGAGATCCGCTGGGGTCCCCGAAGGGACCTGGGGAGGAGATTGAGGTTTCT
CTTCTAGATCTGGTTCCAGATCTCCCTCGTTTCCGTCGACAGAGTTCCTCCCAGCACTCTGTCGATCCGTGGGTCTTGCTTCATTCAGCGGCGTTATCGT
CGATCCGACGTCCGACGACGCTTGGTCCCCTTGTTCAGTCTTcacttgaacttcttcttgggatTCACGGTGAAATCCCGAGTCATCAAAAGatccgggc
acgcgcaccattgtggtgtagcgggatcagcaaaatctgcgaagttgctggatccggcttaccaacagcgcccagacaccgactaacggagggggtgctc
cgatgatccgtgatctgctgaactggtcaccttgtgtacccgtcggtggg