Description :
From Genome Similarity Track
Location :
Scaffold_3903:260- 1293
Transcript NameFunction/comments
Phyta_totarag15540hypothetical protein PHYSODRAFT_339130

Sequence
1033 bases(100 bases per row)
CCAACGTTCCTTGTTGTGACCGCGACCGGGGTCGGTGCCGTGATCTGCTGTTCTTTGAGGAATCGGCTCATATCAGCTTGGAAGTATGATTCCAGTCTGC
TTGTTGATCCGTCCGGTGAAGTTACGTTCGTGATCTGGTTTGGCGGCCTCTGCTGTCGCGGCTGCGTCCGATCCGGGGACTTcccacgagatcgagatct
CAGTAGTGCTTCTCCAGAAGGTCCGAGAGGCATATGTTTCGACCCTATAGATCCATCCGAATCAGGTTCTGATGTGGCCGATTCGTAATGTGAAGAGCTA
GTCTGGTACTCCGTCGTGCTGATCCGTGGCGAGATCTCTGAATCTTCGATCCGTCCATTTCCGCCTACCAAGATCGCTAGTCTAGCGAATAGTTCTTGGG
AAGTAGATTTGATTGTGTCTAGATCCAGATCGAACAGTCCGTCAGCGTCGAAAGCACCGGCAACTAGACCTGCCTCTTTCAGCATCTGAAGTAGGTTCTT
CACCGCAGTCAGCTTGTTGGACGTCTCCGGCGGAGCTGACACTNCAAACTCCAGATCCTGATCGGTCCAAGTCGATGGCGATTCCTTCTGATCTTCGCCA
TCCAACTCAGGGGCCTTCATTTTCGTCCGCGTAGTCTtcaatttcttcttcttcataTTAGATCTTGGGATAGCGGGCTTGTGGTCGCTTCTTTCGTCAC
GAACGCATACGGGTCGGGTTTAGCCTTACcgattttgttttgcagATCTCGATGCGTATCGAGATCTACTGGGTGAAAagggttacggatcttgggcaac
gtgaagcttgggcggagcgaagggNCCTAGCCTACCACATAGATATGCAGCCTGCATCCAATCATTTGGTGCATCCAATCACCAACACTCTGCACTCGTC
CAATCATCCTACTCGTCCAATCATCCTTGGCGTAATCAACATACCGAATCaacgcgggatcgtgttggacaaGTTCGGGTAATTGgaaaggtcgcttgag
cagttgttgataaaatgcaaagtgattgattac