Description :
From Genome Similarity Track
Location :
scaffold_609:26- 8544
Transcript NameFunction/comments
Pl_103470U3 small nucleolar RNA-associated protein, putative

Sequence
8518 bases(100 bases per row)
TGTACTGCGTCCTGGAACCTTGACGTTGGTGCTCGGACAACCTGGGTCAGGAAAGTCGACCCTGCTCAAGGCTTTGAGTGGGCGACTACGTGTGGACGGC
AATCGGCTGAGTGTCTCGGGTGAGATAACGTACAACGGGGAGTCTCAGCAACGTATGGTGAAGCAATTACCTCAGCTTGCGGCGTACGTGCCCCAACACG
ACGAACATTTTCCACTCCTATCAGTTCAGGAGACTTTGACATTTGCTCACGCCTTCAGTACCGGCAGCCAAAAAGATGGTACTCAACACACAACCGTGTT
GTTTGGGCAAGATGCTGGACATCACAATCAGCAGGCTCTTAAGTCTGCTCTTGATATGTTCAAAAACTACCCAGAGGTTATCAAGGAACAGCTTGGGCTG
CAGAACTGCTGGAACACGGTCGTTGGAGATAACATGACGCGAGGTGTCTCGGGTGGAGAGAAGAAGCGAGTGACGACGGGCGAGATGGTACTTGGTATGC
AGCCTGTTGTGTTCATAGATGAAATCAGCACAGGACTCGACAGCGCTGCAACCTTCGACATTGTCAACACTCAGCGTACTATCGCGCACACGCTGGGCAA
AACCATGGTCATTACGTTGCTACAGCCACCCCCGGACGTGTTTAAACTCTTTGATGATGCCATTCTCCTGAACGAGGGAGAAGTGCTGTATTACGGTCCT
CGCGGAAAAGTGGTAGACTACTTTCGTGAAGTGGATCTCCAGTGTCCACCGAATCGAGATGTCGCCGATTTCTTGCTTGACCTCGGAACTCCACAGCAAC
ATGCGTACGAATCCTCAGCAATGGCAGGTGGGATGAAACCTCCTCGTCTGGCAAGTGAGTACGCTGAAATATTTCGCACTACGGACGTCCACCTGGATGT
CCTTGATCGTTTGGAAAGGAGTGTTAACCACGACAGCCAGAGAAAGTGGAGCGTGTACGCTAAGTCGTTACCTCAATTCCAGCGATCTGTGTGGACAAAC
ATGATCACGCTTGTAGTTCGGCAGCTTATGCCCATCATGCGAGATATGAATACGCTTCGCAGCCGAATTGTCCTCGTGTTACTGGTGGCAGTGATTTGCT
CGACTGCTTTTATGGATATGGATCCCACAAACGTGCCCTTGGTGCTTGGGTTAATCTTCATGTCAGCAATATTCCCTCTCTTTGAGCAGACATCACAATT
CTCCATGTTCGTCGAGATGCGTGATGTATTTTACAAACAACGCTCGGCAAACTTTTTTCAGACATCAGCTTACGTACTCGCCAATGTCATCAGCCAAGTC
CCGATTGCACTAACTGAGAGTTTCATTTATGGAGCTTTCATTTATTGGATCGCTGGAACATTGGACGTTTCATTCTGTACGAGGTGATAATCTTCCTCAC
CGTGATGACGGCCGTTCTCATCTTCTTTTTTGTTGCCGCGATTTCACCAAACATTTACATCACTAACCCACTTGCGTTGGGGATTCTCCAAGTTGTGTTA
GTATTTGCGGGCTTTATTGTCACCAGAAGCCAAATTCCAGACTACCTCATTTGGCTGTACTGGATTGACCCCATGTCTTGGGCTTTTCGTGCATTGGCAG
TGAACCAGTACAGATCTGCAACTTTCGACGTGTGTACTTATGAAGAAATCAATTACTGCGATCAGTTTGGCAAGACCATGGGAGAGTATTACCTAGGCGT
GTACGATATTCCGTCAGAAAAGGAGTGGGTGATGTTTGGGATCATCTATCTCGTCGGGTTAATCCTCTTGTTCACGGTACTCAGCTATCTTGCACTCGAG
CACAAGCGGTACGAAGGTGACTTCAGGGCAATCAAGCCAATTACAAGCATTGACGACGAGTCAAGCCATTATCAGCTTGCTACAACCCCCAAGACAAACA
ACGAGGTTACTCCATTCAACTCGACTGAGAGTGATGTGTCGATCGAAGTTCGTGGACACTCAACGACATTTATGCCAGTCACGGTGGCATTCAAGAATTT
GTGGTATTCAGTGCCAACCCCGAGCAAACCGACGGAGTCCATCGACTTGCTGAAAGGGATCAGTGGTGTAGCTCGGCCAGGGACAATAACCGCACTCATG
GGTTCGTCAGGTGCAGGCAAGACTACCCTCATGGACGTTATTGCTGGTCGTAAGAACACTGGGTCGATCCAAGGGCAGATCATGTTCAACGGCCATGAAG
CTACGGAGCTTGCTATCCGAAGGTGCACAGGGTATTGTGAGCAAACGGATATTCACTCAGAGACTGCTACATTCCGTGAGGCTCTCACTTTTAGCGCATT
GCTTCGTCAAGACAGTGATATCTCCATGAGCGCAAAGATCGACTCAGTGAACGAAATTGTGAATTTGTTGGGGCTTGAAGATATTGCTGATCACATGGTG
CGTGGGAGCTCTTTGGAGCAGTTAAAGAGACTGACGATTGGTGTGGAGCTAGCTGCCCAGCCCAGTGTGCTGTTTCTCGACGAACCAACGAGTGGCTTAG
ACGCGCGTTTTGCGAAGATTATCATGGATGGTATTCGCAAGGTTGCAAACTCCGGACGCACAATCATCTGCACGATCCATCAACCGTCGTACGAGGTGTT
TTCTGTATTTGACAACCTGCTCTTGCTTAAGAGAGGTGGTGAGACTGTGTTTTTTGGCGAGTTAGGTGAGGACTGCAGAACTCTGGTTAGGTACTTCGAG
GAAATCCACGGAGTTCAGCCTCTGCCTGAAGAATACAATCCTGCTACGTGGATGCTGGAGTGTATTGGTGCAGGTGTCAACAAGAAGACATCAGAAGGTG
ATGACATCGATTTCGTCCAGTGTTTCAACGAGAGTGCTCTCAAAGTACACTTGGAAGTGATGTTAGAGGAAGAGGGTATTGGTCGACCTTCACCTCATGT
TCCAGCTCTCGTATTTGGTCGAAAGCGCGCGGCATCTTCAATGATGCAAGTGAGGTTGTTGACGCAACGCTTCTTCAGCATGTATTGGCGCTCTCCAGCA
CATTATATCACAATCATCGGAGTGGCTTTTGGAAGTGTTCTTGTGCTTGGACTTGTTGGCAGCGGTTTGTCAACAACTTCATATCAGGGTGTTTTCTCCG
GACTTGGAATCATCTTTGTCGCCTTCCAGTTTCAAGGATTCGTGTCCTTCAACAGCGCAATTCCGTTTGCTTTCAACGACCGCGCAGCTTTTTACCGCGA
GCGTTCGGCACAGACGTATAGTGCATTGTCGTACTTTGTGGCAGGAACACTCGTGGAAATCCCGTACATCTTCATGAAAGGGTTGATCATCGCTGCGCTG
CTCTTCCTATTCATGGGTTTCACTGGATTTGCCAAGTTCATTCTGTTCTGGCTAGCAGTATCGTTGTCCGTGTTAGTAGACGTCTACACTGGACATCTTT
TAGCATTTGCGCTTCCCAACATCGTCATGGCAGCGCTCAGCGGGTCAGTGGTCTCAACGATCTTCTTCCTCTTCGTGGGCTTCGGCCCGCCAGGCAGCTC
CATCTCGGCCGGATATCAGTGGTTATACACGATCACCCCACAGCGTTACGCCATGTCGATCCTCGCTACGTTGGTGTATGGCGACTGCTCCACGACACCC
GAGCTAAACACTGATACAGGCGAGTATGTCAACGTCGGGCCGGAGATGGGATGCCAACCGCTGGATGACGCACCCGTTTCAATAGGCAACGTGACTGTAA
AGGGGCTACTCGAAGACGTCTACAAAATGCACCACGACAACATCGCACGCAACTTTGGCGCGCTCCTTATTTTCATCGTAGTATTCCGAGCTCTCGCACT
GTTGGCACTGCAATTCCTCAACCACCAGAAACGTTAACGACAGCTTCAACTTGTACGTCACTAACGCTTCAATGTCACTAAATCGAAGTAACAGTTCACA
TATATCTCATTAAGTACGATTATTCCGTGGCAGTAGCGATTCGGTGGCGTGTTGTAATCTTATCCTGAGCCAGCCATTCGTCCTTGGTCATAATCGCAAC
CATGTCGCTGCGCAACGTCGTGAAGCGCCGTGAGCACAAGGAACGCGGACAGCTGCGTGAGCGCCGGAAATTGGGTCTTCTAGAGAAGCACAAGGACTAT
GTGAAGCGTGCGCGCGATTACAACAGCAAGCAGAAGCGACTCAAGACGCTGCAACTCAAGGCGGCACTGCGCAATCCGGATGAATTCTACCATCGCATGC
GCGAGACGCGGACGGAAGGCGGCGTGCACGTGTCCACACACAACCATATTAAGGCAGTGGAGACGGAGGCGCTACGTACGTTGAAGACGCAGGATCTGGC
CTATCTCCACATGAAACGAGCTGTAGACTTGCGGAAGGCCGAGAAACTCAATCGAGGGCTGCATTTTGTGGACGCTCCGAAAAACAACAAACATACAGTA
TTTGTGGATGAAGAACAAGATGTCGACACGTTCGATGTGGCTGAACACTTTGACACGGCGCCGGAACTCGCGGACAGAGCGTTCAATCGCATCCGCAAAC
GAGACCTCGAGACGGCGGAACTGCCAGATTTGGCGGCTAATCCCAAGCAGAAATACAAAATGCAGGTGGAGAAGGATGCCATGTACAGGGAACTGAGAGA
CAGGCTGGCACGCGCCAAGAAGATCGGTCAGATGAGTGCCAAGTTGGATCTCGAATGCAAAGTGCAAGCCAAGGGCAAGAAGGTCAAGGTCAAGGGAGCG
GAGAACGGCATGCCTGCTGTTTATCGCTGGAAACAACAGCGGCAGAAGTAGAGATGGAGACAATGTCAATGGATTGATACATGCATTTTAGTTGAGTTTC
AAGCTATGCTGCTGCTGAGAGCTTAGGTCGTCGAAGGTGGTGGTTGTATGCCTTGCGAATCTGGACGAGAAGTTGTACAATGACATCCCGGTTGCCGGTG
TAGATGGCGTTTGCACGACGTAGCAGGTGGAGAGGCATGGTCTGAGAGCAGGAGAAAAGTGAGACAATGCTGGCAGATCAAGGTGGTCAACGTACCTTCT
TCTGTTTGAGAATGTTCAGTGCCTTGGTGATGTTGTGCAGCGCGCTAGCTTTGCTTAGCGGTTGCTTGCCGGATGGACGAGTGATGCCTGGAATGCTACG
CATGAACTCGACCTTTTCGACGATGCAGCATAGTATCACGCCTGACTGGAATTCCGTCAATTTCGCATTTGAGTCCTGAGAAGACAATTGTAACGTCAGT
AATGAGTAGAAGTGACTTGCAATTCATGACGTACATGAAAATCGGAGGTGTTATTGAGATGAACACCCAAACGTTTTAACCACGCGAGGATTTCTTGGAC
AAGTTCTTGCGTAAATGTCGTGCTTTGCTGTACTTCAGCTTTAGACGGCTTGGTCGGAGATATCATCACTGAATCATCACGGTGGTCCTCCAGTTTTTCT
GAGTCTACACAATCTGTTGTCGGGGCAACTGCAACTGCATGACTTTTAGCAATGACACCGCCTACATGAGTATTGCAAGCAACACATTACCTGACAACTC
CCCTATTGCAATGCCCGGCGCCACTTTGTCTAAATCTTGATCGCACCTTGGAGATCTACCAGTCTGACTCAGACCTCTCCTATCTGAGCAAGTTGGCCAG
ATATCGTCTAAATGCTTGTGTTTCACCTCTTTCTCGTTCTTATTTGTTGGAACAAGATCATCATAGTTGACTGGACCGGAAAGCTGTGCCTTCGGTAGAG
GAAACACATCGTCATTCTCGTGATCGCCGTTTGGATCGTTCTCACTCCACACAAGACGGCGAGCAAACGTGTCGTGGAGTTTAATCTGGTATGATGCTAC
TCGATCATCTTTGTTCGTGAGTTTTCCTTGACCACCTAGGGTAATAGCAGGAACATCGAGCAGTAGTGGGGAAGGTAGCACGGAAGCCGATGGTATCCTA
CCAAGCGTGACGCTTTCCGGCTTCCGAATCTCATGAAAGCTACTTGGTGAATGGCTACCCCCTCGACTAAGTGTTGCGTGACTTGCCTGCCAGAGATGCC
ATAATATCCCATAGCAAACCTGTCGATCTCCAACGAGTACACTTTGTTCAGCACAAGGAGTCAAGTAGCGAGGGGGTATCAATCTGTCGTTTAGTTTTTC
AAATGCTTTCGCGATGTTTTCCCTGACCAGCTAAAAGTGAGTCGAACGATGAAAACACGAGCTCAAGGAACCTACCTCATCTCCGAAAGCGTTCGAGGGG
TCTTGACATACGAAAACGATCTAACGTTGAAAACTTGGGTCAGCAACGCACTGGATGCATTGACGCGGCAAAACAACACGATAACACGTCAAGTTGGTTT
TGACACAACAATAGGCACCTTGAAATTTACCAGAGTAAAACACCGTTGCGCATGGGGTCCTGCAATACTCCGTGACTAAAAGTCTGTGCCATGGCAATAC
GCATGAATCCACGCAACAGTGGTTTGAGGCATATTGCAACGCACCTTTTTAATGTCGAACCCGACATTGATCAGCCATTTGTTCACCGCGTGGATCTGCT
CACTTGTAATGTAGGGAAAGCCACGCTTCACTGGAGCACACCCTTTCAACTCATTCAGTGTAGCTTCCACTTCGATAGTCTTCTTTCTTCTGTCTTGAGG
TGACTTGAGGTGCTGTTTCAAAATGTGTTTTTCCTCTTTTTCGCTCATAAGGGGAGTTTTGCGGTCTATGGTGATTCCAGTTTTTGGAGGTACAGTGGTG
TGAGCAAGCCGTTCAACCCGATTCAAGACTTCTTCTAATGCACACCAAATTGTTTGTGATGACGCTTGTTTTCCTGGGCGTTGCAGACTTTGAAACGAGT
TAATAGCTTCAGGTGAAATACCAAGAACTTTGAATGTAGCTAGAGCAAATTCAAATTTCCTTCGTTTCCCTGCCAGCGTATTCGTACCAGCGAAGTCCAA
GTCGTTGATCTCCGGAACGTTATGATTAAGTTGTTCACCGTAGCGCTGAACGATAGCAATTGCGATACGGTAAAGTAAATCTCCGCTGACAAATGCTAGT
CGGACTTTCCTTGGCGGGTGTAATTTCCAGTCTTCGCAGAACTTCGCAAAAATCTCTTTCAGAGGAATCTCAACGTTAAAGAAAAACCGAGCCGAGTTAC
AGAAGCGAACAGCGAGTGTTTCCTCCCTGGTAGCATCAATACATTCGCCGCTCGAAGTTTCATTGGCAAGTTGGCGTTTCACAGCCGGATCGAGCATACC
AAACGCACGGAGTCCCTTGTCGTCGACAAACGAAGTGGTTTGGCTCGATAACTTCTTCTTGGTGATAGTGTTTCGAGTATTTGTTGCTGCGTTGGATGCT
GAAGTCGTACCAAGTCGTCTCTTGACACCAGCAGTCCGTTTGATTTTGCTTTGCTTCGTTGGTTTAGGTTCTGTAATGCCTGCTTTCTTGATACTATTGA
GAGGCTTGGTAGCTTTCACCGTTGTTTGTGATCGGGAAGAAAACATTTGAGCGCGCTTAGGCTTTTGTTTAGATTCGGGATTCTCGTGTAGCCCTTGTTG
CAACGAGTGCTCAATCAACTGTTCTTGTGCACGTCTCCTGCGAAGCGCGTCCTTTTCACTCTCAAAAGAGTGGTGTTCCTTAATGCGTCGGATGCTTAGC
CGCTTCAGGACCGTGAGCACTGCGCAAATGGCCTCATTTTCACCCGACCTCACTCGGACTAAACAATTCGCATCATTCACGACATACATGGCGTCTTCAT
CCTGACTTCGACATTCGCTCGCAACAAATTGAATAACTCGACGGAGAAGTTCCATTGCGTGACTCTCAGCCGGATCACTCTCAGATACTTTGTCGACTCT
TGTTCTCCCTACGTCTGAAAAGTGCTTCATGTTGGGAGACGTACATGAGTTAAAACTAAGTGGCTACGCAAACGTGAACAACATACCTGCAGCCACAGCA
TAATTTCGTACAACACGTCACCAAAGCGCAAGTCGCTCAGCTCCTCAACCAACAAGCACTTGGTGAGTGGCAACGAATTGACCCAGTGCAGCAGCAACCG
CTCACGCACCGACTCAATTGCATCCTCATCACCAACAATGTTAGTGACAATCGAAAACTCCATCGTGGACGAACTTGGAGACTCCCACCTCCACACATAC
GTTGTCATGGATCTTGAAGGGTCACAACCTGAAAACTGCCAAGCGTGGCCATGTACATGTCGGGAAGCACTTCCACAGGCACATCTAAAAGCTGTTCCTA
GTTTGAGGATGCACCGACATTGCAGCTGAAGTCGTGCTACTTTTCCAACTCGAACAGCCAAGTTGAAGACGCATGCGGTTGTTGAGTCCAATGTCTGACG
CAGTTTCCGACTGCGATAGCCGGACGGCGAGCACGCACTTTGCTGTTTGAAAGTCCATTCGCCAAGAGATTGCTCGGTCTGACGTGTTTGCCTTGAAGCA
CTGGCAATTCCCATCCATAGACAGAGCGGAGAGAAACTCGAGTCACGTCCATGGGAAGTTTGACGCTTTTTGCTCACAAAGTGTCGCCGCTATATCCGAT
AGAAGTCACTGCTTCTTG