Description :
From Genome Similarity Track
Location :
Scaffold_336:26- 4557
Transcript NameFunction/comments
g17511.t1hypothetical protein
g17512.t1XP_009527712.1 hypothetical protein PHYSODRAFT_501310 [Phytophthora sojae

Sequence
4531 bases(100 bases per row)
CCGGGCCTGGACAAGAAGAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACG
CTACAAGCAGTGTCTGCCGGGCAGACACAGGGGTTGGAGACGACCGTCGAGACATTGAGTGTCTTGACGCGTACGAGTATTGGTCTCCAATACAGGAAGA
TGAGGCTGAATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGACCTGCACGATGGACGCATCGA
GCAGATCTGCATCCTCTCTGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCG
AAGAAGGAACGCTTCGACGAGAAAGGCGGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTC
CTGCGGAGTTACCGCAGGATAAGGGTGTTTAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGGCAGTGGCCACTGCCGCGTGAGCA
AGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGTGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTCAAGAAG
CCACAGGGAGGGTGGCGCATCGTTCATGCGTATAACAAGCTGAACGACGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATT
CGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACAGCGGTAAGCAC
TCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCACAGGGTCCAAAGAACGCCCCAGCGACGTTCAACGGGTGCGTCACGCACTTGTTGCGCTCGGTG
CGCGACTTCGCACCGAGCTATTTCGATGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAGATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGT
TGCTTGAGCTCATGCGAAAGCACAAGCTGTATGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGATGAA
CGGCGTACGCCCTGACCTAGGAAAGGTCAGAGTGGTCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTAC
TTGTGCAAGTACGTGAGAAACTACGCGGGCAAGATTCGCCCGCTGTTGCACCTCTTGAAGAAAGATGCTGCATGGGAATGGCTGCATGGGAATGGACTGC
TGATTGTCAGCAGGCCTTTGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAATATCGCCCATTCCACGTTGTGTGCGAT
GCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGTGTCAGCTGAAGCCAGCTGAGC
GCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAACGTTCCGAGTGTATCTACTTGGGATTAGACCATTCGTGGTCTACAC
CGACCACGCATCGTTGCGTACGGCGACTAAGTCGCCGCACATATCCCAAAGAATGGCACGGTGGCTGTCATTCTTTGCGGAATACAACTTCCAGGTTGAG
TACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGAGGTGCACGAAGCCGACGCCAACTGCGTTGGTGTCGTCAGGA
CGACCACACCCTCGTCGTCCTTACTGGATGACGTGAAGGTCGCATACGCACATGATGCGGATGCGAAGCAGTTGTTGGAGTACTTCTCCACACCTTCTGA
CAAGTCTCGTCAGAAGCTGGTCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCATTACAGCGCAGTCGACGACAACGCA
GATCGCATTGTCGTGCCGGATGATCATGAGCTGACGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACAT
ACTTGCTTCTCACGCGTGACTTCTACTGGAGCCACCAGTACAAATGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCC
CAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGG
AGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGATGGCATGTCTGTTTG
TTGACCTGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACATTTCT
TGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGTTGGTTGACATCATGAAGAGCTACGCA
CACTCGTTCCATCAATGGAGCGACGGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATG
CCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTTCTTCCTTAAGTGGGGGAGGGTATCCGGTTAAATCGAAACAACCGGATAAGCACGC
TGATACAAGCAATGTATCAGCTGTAACGACTCGCGCACGCACTGCGCGCAGTCATGGCGACGACAAGACAGTATCTACGACGGGCGTAGACACTTTAAAC
GACAACGAACATCACGCGCAGGCTGGGCCTGCTGCGAACAAGGAACACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGTCGAC
AAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGAAGCTGAATGCCGATAATACCGGCAGAGGAAACACAAATGAATTTAA
AGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGTAAGCTTGCTCCGCGCTTCATTGGGCCATTC
ACCGTGTTGGTGAAGCATGGCAACGCGTACACACTGGACATACCGCCCAGCATGCGCCTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGC
AGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTCAAGGCGCCAGAGAGCCTCGTCCCGACCTCGACCTTCACG
TTCGAGGTCGTCTGCGCAACCTCTGCGAGCTTGTTGACTTCAACAAGCTCAGCTCCTGACGCAGAGCAGCAAACTGCGACGTCTGATGGTGCTCAACAGC
CTCCAGGCGAGACTCAAGGTTGGGTTGATCAAACCCGGGGCGTCTTCCCGCCGCCCCCACCCGTTGCGAGATGCACGCGGGGTAACTCGCTGGATCGTCC
AGCGAATTGTTGGTCATCGGAACCAGACCCGAGGTCCGGTTCATTTTCGTATCGTGTTAGGGAGGAAATCCTCTCCAGAATCACGGAATGCCCTGATGGA
GGACATTCCGGAAATGGTGACGGCGTACGAAGGCCGCCACCGCCACCTCCGCCGAAGGGCGTAAAACTTGGGCGAGCGCTGTAGTCGCCTACAGCACTCC
GATAAGTGCTGCGATTATCCGCAGCACTAGAAGACGCCTGCGCCTGAAAACTAGCGCGCAGGGTCTTGAGGTCGTCAGGTACACACATGGACGTGTACCC
GTTGATGTCCCGTTCAGTAATGCGTACTGCTCCGGGGTAGCAGTACTCACAAGCACTGTCATAAGGCACTGCGCAAGGAAGTCAGATACCGACTGCGCCA
TGGTGCAGTCGTTCAAGTTTACCACGCTTCGAGAACTTCTCGTAGCGCTCCCGCGCCTGGCTAATCCGGTCGCGATAGCCAGCGGGGTTTTTGTTGAAGT
TTTCAACAAAGGCACTCCAACTCTGACAAAGTGCCTGCCACTCGGGCACTTTGCTTCTGCGAGAAGTCTTCTTGCTCGCAAACCATCGGAGCTCATGGAA
GAGCCCGATGTAGTAGTCGCGCCTTTGGTCCGTCATCGGATCAAAGTGTAATCGCTTCGCAACGTCATCGTCAACGATGGCGTTGCACGAATACAGCGCG
TACAGATTCGGTGACACGGTCGCACCGAATCGGCTGCTGATCTCAAATTGAGACGGCATCCACGGCTCGCGCACTGGCTCAGTGCGCGAGGCCGCAACAA
CAGCGGATGGAGCAGAGTCATCTCCATCCCG