Description :
From Genome Similarity Track
Location :
Scaffold_2875:26- 2742
Sequence
2716 bases(100 bases per row)
CGTGCCGGCACAAGTATTGTGTCACGAGGCAATGGCCTCTCTTGCGCGAACAGTGCGAGGTCATTGATGCTTTCTTCGCCGCGAAAGCGAAGGCAGGCAT
GGTGTGGGAGTCGAAATCCCCCGCACTCGACGCCGACTTTTCTGCGCTCGGAGGCCGTACGGGAAGTGGGTGTCTGGGATCACGCTTATACCAGGCTGAC
CAACGCGACGATGCCGGCCCAAACACTAATTCCCACGGAAAGGATGTGTGGTGGACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGA
CGGATACTACCCAATCTTGATGCGAGAGAGCGACATCCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTTGGGAAGTGGCTCGTCATGCCGCAG
GCTTTGTCTAACGCCCCGGCGACGCTCAATCGCCTGGTGACGCAATTGCTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACGTATTCGTCC
ATAGCCGTGCCGAGGGACGCAAGACGGCCATGTAGGTGCATCTAGGACACTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCAACATC
GACAAGTGCGTTTTCGCGTCACCAGAGATTAACGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGCTCGAGCTGACCCAGACAAGGTCAAGGCCATAGCAG
CATGGCCGATGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGTGCAGGGTACGCGGGCTTCGCTAAGCC
CTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGCCTCCCAGAGGCCCCTGTC
CTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGACTACGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGAACAGG
AACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAA
GTTCCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATG
GCGAGGTGGATGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACGAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACT
ATGAGTTGGCCCACATCACGCGGGTGGCAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATAAGGCTGTCGCGCCTATCGTCAAGTTCCT
TAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTTAAAAAGGGTCTCCTCTATTACCGGGTG
GAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGTGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGG
GCCGCGAGAAGACCTTCCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCG
GGTCAAACCCGCAGGGTACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGGTTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCC
GCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTCCCCGTCACTGTAACGGGCGAACAAA
CCGCAAGGTTGCTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCCGCGTTTTGGAAAAC
GCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACCGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACT
CTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTCCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCA
CGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACCCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGC
TCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCACTACGGAAACAAGTGAAATCCTTGGTGGATACCAAGCTGAGCGTTGTCAGCAGAGTCCGCGAT
GCCATGGCAGCGACCCAGGATAGCCAATAGGGGTACTCAGACAAACATGGAAGAGGAAACTTATGTGTATTTAAAGTGGGGGACTTAGTGTTATTAGACA
CGAGGATCCTACCGCTAGACATGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCGTTTGCAGTCCTGACCAGATATGGTGCGTCGTACACCATC
GACCTGCCTAAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGTACGCTGATCCGCAGGGGGTTGCTGACTCGCAGACCCACCTTG
GCCTAGCTCCTCGAAG