Description :
From Genome Similarity Track
Location :
Scaffold_802:26- 2060
Transcript NameFunction/comments
Phyta_totarag10790hypothetical protein PHYSODRAFT_562727

Sequence
2034 bases(100 bases per row)
TGGAccgaggagcagctggaagctgccTAACTGCATGCCTTCTTGATCCAGAACCCAGTGATGCTGATTCTCCGACCAAGCATCCTGGATGATCTCTCAA
GGGTCCCGTGTCGAAACCGATCACTGGGTCGAGCAAGCAGGACGCGGTGAAGGCGttgctccaactgctgaAGGAGTCTGGAATCATCGCTGGCGCGTTT
GAAGCTGTTGAGCTCTTCGATCTAAAGCTTGGCGCGATCGAACATGCGCTCAAGACCCTCTACGAGACGCTGAAGCCCCTGGTTGGCACGATCAGCCAAC
CCACCAAGGAGATTGTGAGATCGCAGCCGACACTTGCTCCGGACGACCAGACCGGCACGTCGTCGCACTGCGAGTCGGCAACCGAAGAAGTAGACTCCGA
CAGTGTCGATGATCCGCCGCAAATGACGCTGGGGCCATCCGGTGCCGCTATGCTGCGAGATCGAGCTGACCGAACTGAGCGCGAATCAGTAGCTTCGACC
CAAGAGACGAAGGTCGCAGCAGTAAACCCGATACGCCACTCGCCAGAGAGGCTGGAGTCGTACTTTCAGGCTGCGATGGGACGCTTCCTGAAGGAACAAC
AGTCCACTCCCCGTCCACGTGTCGCGAGAccgactggagatcaagacgtggagatggagtcgGTGGGATCGCCTGATCACCACTCCTCTCCATGGGAATT
CGATCCCGACTACCTCGATCTTACCACGACTACTCGCGCAGCAGTGACTGCGACAGCTACTTCACAGGCTGGAAGATCGACAGCCGCTCCACGCATCTGC
GTGTCGGCAATGTCCGAACTGAAGGAGTTCACTGGAAAGGAGGGCGACGAAGATCGTGCCCGGTCCTGGATCAGCAAAGTGAAATCAGCGTTCATCCGAG
ATCAAGCACCTGATGATGAGAAGTGCCTGGTCTTCGGTGATCTCCTTACTGGGCCAGCGCGGAACTGGTACCGGCAGTTGAGCCGCACGACTCGCAGCAC
TTGGAAAGACCTGCTGTTGAGTTTCCAGACGCAGTACCGCGGCCGTGGTGTATCTGTCGCGAGACAGTACAACCACGCGCGGAAGCGATCGGACGAGTCG
CCGCTGGAATACTTGCACCGTCTTAACGTAGCGGGGCTCCGTGCACGTCTCCAAGTGAAGGATGGATCTCCAGAGACCCGACGTGAACATGTCGATCACT
TCATCGAGACACTGGATGATCGTGATCTCGCCGACCACCTTTCCCTGTTGTGAATCCCAGATGCCGATACCTTGGAAGAGACGCTTCGATCGCAGCAGTG
CGAAGGTGCGTCAGAGCAAGAGCGTCTATGGATCGATCAATCCCCGAACGAGAGCACAGGCCGCAGCCCTCACGCGAGCAATTCGCGCGATCCACGTGGT
AGACGACAGTAGTGAGTCGGAAGCGGAGTCGAGCGGATCAGACGGCGAAGCGGGACTACGCAGAGTGTACCTGACGGCAGCTGGAAATCGTGATGATCCA
CAAGATTGTAGACCACCGGATCAAGACCGCGATCGTACGGGCCCCCCGAACTGGAACCACCAGCAAGATCGACACACCAGATCGACCGACCTGGGGACGC
CGTTCAAACGATGCTCGCACTGCGGGTCGCAGAAGCATACCGATCTTGGATGCTGGTGACGCTTGACCTGCGAGAGGTATGGCCGAAAGAGCCAGTCGTC
CGACCGATGCTTTATTGTGTGCAAAGCTTTCGGCGAGATCCATGACTCTGGCCAATGCCCGATGGAGGAGTTTTACAACTTGATTCGCCAGTGGTTTAAC
CCCACCAAGCACGCAGGCATGCTGccggagacggcggagaagatGTTAAACTAGGACGCTCGCCGGTTTTGAACCCGGTACGAGACGAGCGTTCTAGATA
CTGCGTCTATGCATATGTCGAGAAACAATCGGAGTCGATGGTTAGCAAGCTGATGAATCCGATCGACAATACATGTGATCTTCATGGGAAACCTACCGCT
GCTGTCAAGTTTGCACAAGATGGACGAGTATTCG