Description :
From Genome Similarity Track
Location :
scaffold_1487:26- 1972
Sequence
1946 bases(100 bases per row)
CAATGTCGCAAACATTTGTACACGTCATCCTTGATCGCCTTCCTGTCGACCACCGGTACCGCACTACGTGTCGACTTGGATCGTGTCTGAGCTTAGATCG
TGGTCCCGATTGGATCGCGGGTCAGATTGGATCGTGGTTGAATCAGATCGGGATCGCGGCTGATCCGATCGACTCAGATCTGATTACCTCTGGCTCAGAT
CGCGGGTGGCTATGGGTCACCGGGTCACCGGGTTGTGGGTCGCTGGGTCGTGGGCTCTTCTGGGCTTGTCGGATCAGCTGGGCCTTGAAGCCATGGTCGG
GCTACGTCATCGCTCTCAATCGGGTCACCAGTTTTCAGATCGATGTGACTATATCACATTCGCCCCCTGCGTTCTACCCAGTCGTACAGCGCCCGTTAAC
GCGCATTCTTCCGCTTGCCGACTACCAGATCGCAGCTTACCTGTTGCTGCTCATGTCCGACTCCAATTCGTCGTCGCCAGGCGGCCATGCTGATCCTCCT
TCTGCTCTGAGCAGAAACTCGGTCTCCTCGACACATCCAGACCGCGCTCCGCCCCCTCTGTCCGTCGTTATCTCATCGGTAGACCCAGTATCTATCCAAA
GCCCTCTAGACACCGTCGTTGCAGCTTTATGTCGTGCCGATGAACTTGTCGAGCTCGAAGAAAACCATCGTAACCTTCAGCAAGCGTATCGCACTCAAAA
GAATCACATTCGGGAGCTGGAGCAAGAAGTACGGGACGGGTATGCTGCTGCAGCTCCGTTCGTTCAGTTTGTCGAACACAAGTACGACCTGATGCGCCAT
CAGCGGGATAAAGCTCGGCCTTCGCTTGCAGATTGTTTGAACGTCCTACAGGACCGCCGCGACAACTCAGTCGAGATCGCGACCGCCCGTGAGCACCTTC
GCCTAGCTGAGGAGATGCACGCGGATGAGATTACTCATCTGAACTCGCAAATCAACGACTTGGAGTCGAGTATGGCTTCTGCTCGCTCTGCAGCCGCGGT
TTCTCCTCGTTTGGTCCGGCGTCTCTCCGCATTAGGCCGAGAGCTAGCTGAGGCCATCGCCACACGTGATCGTCTGGCGAGTGAGCTTGCGACTGCCGAA
AATTCCTTTCAGTCGTCTCGTGAAGAGCTGCACCGCACTGCCGCCGCTGTTCACGCATATGAAGTCTCCCAGAAAGGACTGAAGGACTCCGTCGCGCAAC
TTCATGATCAGGCCGGCGTCTTAGAGCGTCGACTGGCTAGTACACAGAGGGAACTGACCGCTGTACACGAAGAGCGCGATCGCTTCAGTGATGGCGCCAT
CACAGCGGAGGGAGAGGCTCACCGCCTCACCTCCGAGCTCCAAAGTGTCACAGCCGAACGGGACCGAGCCGCTACTTCTCTTCGAGACTCCCGTAAGTGC
TTCTCCATAACTATTTTCACCTGATTATGCATCTCTGACTTGGTTATTCTTGCATGTTGATCAGAGAATCACGTGGCTTCATTCCGCGCGGCGATAGCTC
GGCTGGAGGGTCGGGCGAATGCTCTTCTCGTGGATCAAAACCGGCTCCGGGATTTGGAGCAAGAAGTCGCTACCCTGAGATCGGTCAGGACTTCTCTGAC
GCAAGACCTCGACCAATCAAGGGTCGATTACCGAAACCTGGAGGAGCAACGCGACCGTGTGGCGCGTGAACGGGACAAAATGCGTGCCGGTTGGGACACC
GCAGTTTAAGAACGCGATGCGATCCGGTCTCAAGTTGCTGGGTTGGCATCTCTGGTCGGTGTCCCGACCACCGGATCCCCTCCTCCACCTGCCGCTTCGC
TTCCCTCCGGCCGTTCTAAGCGTCACCACAGCCGCTCCACCGATCCTTCGTCTCGTCCCTGTGGGCGGGCTCGTAGGGACTCATCCCGACACCGAGATCG
CTCTCATTCCCGAAGGCTGACTCCTGGGAGTCCGAGAGGGAATCGT