Description :
From Genome Similarity Track
Location :
Scaffold_2681:26- 1067
Transcript NameFunction/comments
Phymu_g14263hypothetical protein

Sequence
1041 bases(100 bases per row)
GGATCCCAAGCCTTCAATGACCACCTAGCGACCAAGATCCAGGCCGCTCTCGGTCGCCCACTGCCCCAGATGGAAGTGCGGGTCAAGAACCTCAGCGTTG
CAGTTGATGTGGTGGTCGGCCGCCACGAGAACGGGCGGGAGCTGCCCACGCTCACGCACACCATCAAGACGGCGGCGCTCAAGCTgtcggccaagaagca
cgtggtgCACAAGACCATCCTGCGCAACTTCAGCGGCGTCTTTGAGCCGGGGACCATCACGCTCGTGCTGGGTCAGCCGAGCTCCGGTaagtcgtcgctc
atgaagATTTTAAGCGGACGGTTCCCGCAGGAGAAGAGGGTGGCGGTCGACGGAGACATCACGTACAACGGGGTGCCGCAACACGAACTGGGCAGTCGCT
TGCCTCAGTTCGTTTCGTACGTGGACCAGCACGACGTGCACTTCCCGACGCTCAcggtgaaggagacgctggagttTGCGCATGCGTTTACGGGTGGGGA
ATTGCTGCGTCGAGGTGACGAACTACTGGTAAATGGCTCTGCGGATGAGAATCTGGAGGCTCTCAAGACTGTACAGACGCTGTTCCAACACTACCCCGAC
GTTGTGATTGAGCAGCTCGGATTGCAGAACTGCCAGAACACTATCATTGGCAATGGAATGCTTCGAGGCGTCTCGGGTGGAGAACGCAAGCGAGTGACGA
CGGGAgagatggagttcggcatgaagtacatgacgctcatggacgagatcagtaCGGGCTTAGACAGCGCTACCGCCTTCGACATCATTACCACGCAGCG
CAGTATCGCTAAGACTCTCGGCAAGACGGTAGTGATCTCCCTCCTGCAGCCGTCGCCCGAGATCTTCGCACTTTTCGATAACGTGTTGATTCTGAACGCT
GGTGAAGTGATGTACAATGGACCTCGGGACCAAGCTTTGCCGTACTTCGAGAGTTTGGGTTTCCATTGCCCACCCCACCGTGATACGGCAGATTTTCTGT
TGGATCTTGGTACGAACCAGCAGACGAAATACCAGGATGCG