Description :
From Genome Similarity Track
Location :
Scaffold_1:25997- 28803
Transcript NameFunction/comments
Phyta_totarag7conserved hypothetical protein

Sequence
2806 bases(100 bases per row)
ATTGCATCTGGCAAGCTTACTGTCTCAAGCAGTTCGCCAGCAATCAGTGTGTATACGCGAAGCACACTACGAGTCAGGGCCAGGAAAACGTGGCGGTGTG
CTGCAACGTCTAGCACGTCAAAAGCCTGGCCATTGTCGTCTTGAGCAGGCGGTTGCCAGGGTGTCAAAGTTGTTAGCTTTCTTGTGAAAAGGGTAGTACA
AGATCCGTTGTCGCGCGCATcgttgctggatgaagaagacgagctcGACGATTTTGGTGTCAGGAGGTATACTTCTCCAGACTCCCGGTGTAGAATCACG
AGCTCGCCAGTCATGCTGTGTAGGCACATCATGATCTGTGACATCTCTGGAGCCGTGCTGCCTTCATCAGGCGAAAAGATGTTGTGCCAGTCCAGAGCCA
CAGTCCGAAGTGAAGCCATCGAGCTACGGAAGAAAACACCCTGCGTTTTGGAAATCGCAAAAAGACCGAGTttcgagctcagcagctttACAACATCGTC
GCACATTGGCTTTGGGGTAAACGTACTTCCAACAACCACATCCGTAGCCCGCAGTGCATCTGTCGCGCGTTCAAAGCGCAGCCGTCGAAGTTTCAGCTTG
GGCTCGTGCTTAGTTGCCGTCGACCACCACGCCAATTCTGTCGCACCACTGGAACCAGCTCCATTACCACTGCTACCTCCAATGTCCACACTCAACCCCG
ACATACAGCTGTCTAGCGGTAAACCATTCGTTGTAAAGGCTGCAACTGGCCGCGTCCACTTTAAATTCGGGTTCTCCAAAAAGCACAACCTGTTCAAAAA
CACCCACTGGAACAAATCCGCTTGCCACTCCCACAGAAACGCCATACCGTCTTCCCTGGCCACCACACATCTCaacggagctgcagctccaacgACCCTC
GAGAACGTTGCAGCacccgacgacgacgacgaattAAAGGACGCAGAAGAGTCGTTCAGTCCTCTGCTCCCACTTCGAGTGGGCTTCGGAGGTTTCTGCT
GACCCCCTCCACTCCGAATAAACCTAATGGAAACCACCCGACAATCAAACCGAGCACAGAGCAACGGAGCCTTGATCAGTACACTGCCTTCTTTGCCTCC
TGCAGCCCGTGTATGAGGTGCAAAGAGCTCTTGAAGCAGTTCCAGTTcatccacctgctgctgcggtaATTGTACCCCCGGGGTCTTGTTTTTCCTAGAC
TTGGTCTTGTTTTCTTGAGTTCCCCGTCTTGAAGGCGGcagtgcatccagcacgtAGACAAcacgtggagcagctggagctgctgccgtgggGGTTGACG
GCGTCGTAGTACTACGACTCATAGGGAGATTTAATTGTACCCCCGGGGGACGTCGAACCAATACTAAAGCCAAGTGACCGGCCGTTGGAACGCAAAGCTC
CAGTTCATAGGGAAAGTCGGCACTAAACTGATGGTTTTCgtgaccttcttctccttgatcttctctTCTTTCTTGGGTGCAACTGGCGGATGTTAAGGCT
CGCAGCAGACGTGCACCACGTACTGCAGGCCACGTGAGACCCCCACTCACCACGCGCGTGTGCTGGGAGGACGCAGTGGGGCTCCCGCCGGGAGGGATCG
CCATGGAGCTATCCCGGGAAGATTTCCGAATGGATTATCAATCGAAGGGACGAATTAAGATAAATCAACACAAGTACTCTAATTCGTTGATGGATGAAAA
TATGTGACGTGTGAGAAGAtaagatggctacagtcTCATCATGGGCTCGTTATCATCTTCTTCTAGGAGTACAGTACGGCAACGCCGAGAAATTCTCGGC
GAGTAACTTATGGCCAGTGCAATCAAGAAGGACATAGAGACGGTGTGTGGAATCAAGAGAATTTGGTCGTCACGACCAAGATTATGGTCGGGGCCAAGGG
GTTACGGAGGGGCTGAGTCGCCAGTATATCGTCGAAGGCGCTCCTCGACTTGGAGCTTGACTAGCCTTACGTGGATGTCACCTTCTGCCACGATCCTCAT
TGAGAAGACTGTTTGAGCCATGAACCTCGTTCAATAAAACTGGTAATCATGGCTATCCGGACCACGCGGTCGGATTATCTACTACCCTTGACGGGAGGGA
ACGCGCCGGCGGCCCGATggcttgctcttctcgaAGCCCGATGTAGAATTGGAAGTTGGATCTTTCTATCGAGGAGCGTACGCCTTACGGTGATTGATCC
ATGGTGAACTCAAACCCATCGCAGGGCGATCACTGGTCCAGCTCACAACGTCGTGGTCGTTCGTCTCTAACGAAAACGTGTCCATCGCGATCATCGGAGC
AAGGAGCAAGTCGTCCGCCGCAACTCGAGGAAAACGCCAGGGCGCTGGATATTCAAATTGGCACCAGAAGTAAAGACGAGAATCGAGTCCAGTGCCTCGT
TCGTGCCCCATGTACCCACAACTTGCTTTCTTgcgccaacaccagctcTATTATAATAGGAAGCATAGGTAGCTTGCCCTGAGGATCAAACATATAGCTG
CAACGCATGCTTACAATTCAGATGGTCGCATGAACATGGATCAAATTGAACAGTTCAACAGTTCAACGTAGTTTGGTCATGATGTATCAAAATACTACAT
AATCACCCCAACCACGTTGGTTACCTCCACGGTATGTTTTTCAAACAAGCTGGTGGCATTCCTCGGCGCGCCAATTGCCAATCTTTTGGGCACAGTCTTC
GTTCGCCTTGTCGTTGCGAACTTAGGTCAGCAAGCGCTTTCGACGGAGGTCAGGCAGGCGAACCCTTCGATCGGACGACGCTACAGtatctctctctctt
ttaACG