Description :
From Genome Similarity Track
Location :
Scaffold_30:259817- 267945
Sequence
8128 bases(100 bases per row)
TCCAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTCCAAGTGGATCTGGTAGTCAAGTTTGAAGACTTTGACAGCC
TCGAACTGCTCACTGTTCTCGATATGGATCCATATGATATGATCTTGGGCATGCCCTGGCTTGAGAAGCAAGAGCCCAGGATCGACTGGCGAGGCAAGGC
AATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGGTGGGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCAGCAAGGGCTGCCAGGGTACC
AAAGCAATTGGCAGATGCTTGGGGGTCGTCGACGTATATGAAGGCTCCGAGGATGCTTTGATGGTGGCAGCGTCCAGAAGCGGCGCTGGCCAAGTGGGTA
ACTTAGGTCAACAGGCGGGTAGCTTAGTTCCGCAGACAGCTGCAGCTGTCATGGACACCGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCAC
GGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTCGAACAGGCTTCCTGTGTGGGTACCACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCG
CCGACATTTCTAGACGTGGGCAGCAAAGCTCCACGTCACGGTCGCCGTCGTCAACGACGCCGCCGCCGGCTCAAGTCGGATCCGAACTTCGTTCAGATCG
ACTTCGCTTCAAGCGACTCGGAGTCCGGGGACCGGGCTCCTACGACAAGGCCGGTGAAAGACTGTTATCACGTCTTCGATGGCGAGACCGGAATACCCGT
TAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTGGAGGAAATGACGATTGAGTCTTTCCTGGCAAACCTCAAGGCT
GGATAGATTGCTGAGATGGTGCTCACGAGACCTGAGTCCACTCGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACCTAAACAA
GCAGCGTCAGACGCGCTTGGGTTCTGAGATCCTTAAGAACCTTAAGGATCCGGTTTATTATTTGGTGACGGAGTATGTAGACGTGGTGAACATTCACCGA
CCCAACTCCCACCGGATCGAGGCGTACGGCTCGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTG
CGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCG
AACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACAGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACA
TGGCCGGGAGCGTACTGTAGAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGACATCTCGCTCACCGCGGTAAGCACTTC
AAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCCCAGGGCTTGTCTAACGCCCCGGCGACATTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGT
ACCTTCGTACAAACGTACTTCGACGACATATTCGTCCATAGCCGTGACGAGGGAGGCAAGACGGCCATGGAGGTACATGTAGGACACCTCCGTCGAGTGT
TGGACGTAATGCGAGCGAACAAGCTCTACGCCAACATTGACAAGTGCGTTTTCGTGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGG
CGTTCGGGCTGACCCAGACAAGGTCAAGCCATAGCAGCATGGCCGACGCCCCGATCTCAGAAGGATCTTCGAAAGTGATTGGGCTTGGCCACCTACCTTC
ACAAGTACAGCGCAGCGTAGTCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGAAGCTAGAGCACCAGGATGCTTT
TGACAGCATCAAGGTCAGTCCCCAAGAGGCCCCTGTCCTGGCCCTGCCGGATCAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATC
GGATGTGCATTGCTGCAGACCGGCACGGCTGGACACGAACGAGTCATCTCGTTTCAGTCCTGGCAGTTCAAAGCCGCCGAGCGGAGCTATTCTGTCCACG
ACACGGAGCTCCTGGCAATAAAATATGTCCTTGTGAAGCTTCGTGTTCACCTTCTGGGCTCTCGGCCCTTTCGTGATCTACACAGACCACGCATCCTTGA
GGACGGTGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAGTACAACTTTCCGCGTCGAATACAAGCCGGGCAAGC
TCAACGTGCTTGCGGGCGCCCTTCTTGCGCCGTCCTGATTAGAGTTGCCCACATCACGCGGGTGACAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATTAATGTTGCGTTTTAACGCTGAACTCCTCTTCCGTAATGAC
TTAATTACAGAGGCTTTTGCCTTCCTCGTTGTTGCCCCGGAGTTGTTTGTTCCCACCAGGCTGCGGGAATTGTATTTATTGTCCCCGACCTGAGGGGTGT
GGCGCGGGTTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCCGACAAACATGACAGAGGAAACTTAAGTATATTTAAGGTGGGGGA
CTTAGTGTTGCTAGACACGACGAACCTACCTCTTGACACTGCCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTG
GCCAGACATGGTGCGTCGTACAGCATCGACCTGCCAAAGTCAATGACGACGCACCCGACGTTCTATATTGGACGTCTTAAGCGGTACTTTGATCCGCAGG
GGGTTGCTGACTCGCAGACCAACCTTGTCCCAGCTCCTCGAAGCGAGGGCCGGTCACTGACGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTC
GGAACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCGTGCGAACGGACCCCGGAGCCATACGCCGAGTACGCTGAGTACGCTGAGTACGCGG
GGTACGCACTATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGAACGTGGCAGCAGAGCCCCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAC
ATCGGACGAAGAGGCCCGGCGATCCACCCGCAGATGCAGGCTCGCGACCTCTTGCTCCTACAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCG
GCCTGGGCAGCAGCATCACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGTCCCGTGTCGGAC
CCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCCGCTTGACCGGAATGGAGAAG
TCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCAGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAGCTCGTG
GGGCCGATTGAACGGCTCCTGATTGACTGCCAGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGA
ACAGGGTACGGACGATGAATACATTCCGTACTCGCGCTCATCGTGAGCGCTGGATGCCGCGCGCTTCAGGATGTCCCTTGGCAGCGTGCGCTTGCTGACC
AAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGCGGGACAGCAGTTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTTAAGAG
ACTCCACCCATGCCCAGAACATGTCCGCACAAGAACTTCACGTGGGACAGTTCTCGGGCATAACCCAGAGGTATCCCCAAAGAGGATAGAGGCCACCTCG
GGTCACGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAAGGGGATGCGGTGTGGCGTGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCAACGAACAAC
TGTTCTTTCTGAACAAGGACACGTTCGTAAATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTTGAAGAAGAGGTCAGCCC
CAGAGCTCTCCTCGGGAGGCCAATACCCTCTTAGGTTGATGGCAACTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTG
GAAATCCTCCTGCTGCTGGTCGAGGTCATTCGTGACCCCCCGGGGCTCAGAGATAGCACCCTCCTCCTCATCTTCTTCCTCCTTTTCTCCTCTTCATCCG
AGGAGTCATAGATGCTCCGATAAGAGTGTCGAGACTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCCGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGC
TTTAGAGGTCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGAATCTCTTCCTCATCGCCACCAGCTTTGGGAGTGCCCTTAGCCTCG
ACGGCCGGACTCTCAGAGCGGACAGACGTGATCACCTTGATCACTTGCGAGCGACTGCACGCTGTCGTCCTTGTGCTCACTGGGCACTGGGCTGTGCCCT
CCCACAGAGCCCGCAGGAGCGTCGTGCGTGCTCTCGGACTCGACTTCGCCCTCACCGCCACAGTCGAACTCACGTTCTACGAACCGAGGGTTCGGACGGT
TGTCTGGAGAGGCCGAGGGCGACGGTCTGCGGCGCTTGCTTGCTCGCTTGCCCACAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGT
AGCCTTCTTCAGTGCCGAGCCTTTGTCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTTCCGGCAGCAGCCTTGGAGTGTGTCTTCGCACCGCTATGTGCA
GTGCCACGAGGCATGATAAACGGTCGAAGTGGAGACCTAAAAGAAGAGCGCACAGATTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCT
CGCGCGGCCAAGTCGATGGTTTTCGACTTTTAGAATGAGAGTTTGTGACGAACACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGG
GGGATGTAGCGGGGTACGTATCCCTAAGTGTACCCAGGTTACATGAAGTGTGACACGTCATACTTCGGGATATTTGGTACAAAGTACCAAGGTCATTCAA
AGCCAACCATTGGTCAAACGACATTGCATTTCTATAGGTGGCTTATAGTTTGTATTAAACCCAAGCTTTATCTACCTATAAATATACTCAGTTTACATTC
TACTTAAATTAGGTCACTTCGCTCTCTTTTGAAAAAAGAGGGGATCTGTGAACTGTCGTTTACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTA
GCGCAAGGTGCTGTGTGACCCCGTCACA