Description :
From Genome Similarity Track
Location :
Scaffold_468:2598- 4476
Transcript NameFunction/comments
g11354.t1hypothetical protein

Sequence
1878 bases(100 bases per row)
GTCCACATCTGACTTCCCGTGCTCGGCACGACTGTGGACGAAAATGTCGTCGAAGTATGTCTGTGCATACGTCCGATGGGGCCGGAAGAGCTGCGTCACT
AGACGATTGAACGTCGCGGGCGCGTTGGACAGCCCCTGGGGCATCACCAACCACTCCCAGAGCATCCCGCTCGGGGTGCTGACCGCTGTCAGCGGAATGT
CGCTCGCACGCATGAGCAACTGGTAATAACCATCGACTAAGTCGAGCGCACTGTATGCTGTGCATCCAACCATGTTGTTCTGGAGAACATCCTTCCTAGG
AATAGGCGTCTGCGCCGGAATGGTGGCGGCATTGAGCTTATTGAAAGCGTGGACAATGCGCCACTTGCCGTTTGACTTTCTGACACAGAATGTCGGCGTC
GAGTGCGGAGACTTGCTCTCGCGCACCATGCCCGCCTCGTGTTTCGCACGGAAGAACGCGTCAATGACGTCACACTGCTCCCTTGGCAAGGGCCACTGCC
TTGTTACGCAGTATTTGGTTCCAGGGACCAGGTCAATCTCATGACGCACGCCTCGATCTGGAGGTAGGCCAGAAGGCGGATCGTTGGAAACGACATCTTG
GTATTCCTTAACCAAGGGATAGTACGGATCTGAAGGATCCTTCAGGATCGCCGATCCACTACGCGCACTAAGCGCCTGCTTCGTGTCCTCCAGGACTGTT
TCGTCCATAAGGGACGACGAGTTTAACTCATCTTCAGGTCGTATAAAAGCGACCTCGGCTAATTCGCCCGCCTTTAAGGCCTCGCCGAACTCGGCAATTG
ACATTTCGTCCAGCTCTAGCAGAGCATCTGCGGCGGGAACAGCCTCAAGGCTGACGTCGCCAGCGACCTCGCCGGTCACTCCATTAACGAGTGTATATAG
CTGTTCGCTATCCACCACCCCCGACACTTGCTGTGTCATAACAGACGCTTTGCGTCTCGCAGCTGCCACACGGCGTCGCTGCCGTCTCCTCGCGGAGACC
ATACGCCTCGGGGAGGCCTGCATATTCACACCAAAGGTGTCCTCAGGTGTTTCCACTTCTTGTTGCTTCATCGGAGCGTCGACGTCAAACTCGACATCCG
GCGAGGAGCTGCATAGCTCGCAGTCCCCACCCAGTGGGTTATGTGCCACTCCACACGCATCGTTAGGGCTGGGCCTAGGATGCCTCGGCTCGTGGCCGAC
CGCGCCATCGTTGGCACGCAGTGATTCTCCGCCATCGCGGCGCTCACCGCTCAGCGGATAACGTGCCGCTCCACGCGCATCATCAGGGCTATGCCCACGA
TGCCTCGGCTTTCTGCCGACCATGCCATCAGCGGCCTGCAGCGATGGCTCGTTATCACAACGAGTCCCGCTCAGCGGATTACGTGCCGCTCCACGTACAG
CCCCTTCGGGACTCTTGTCTACGACATCATGAGTGTCAATCAACTCCGACACGCCGATGTCCAGCACGTTGACCGTCTCGGTCCAGTGCTCGCGCCAATA
GCGCTTTTGCTTCCTAGCAGAGGTGGGTTCATGACTCGCCAAAGCTTCACCAGGAGGCAACCGCGTAGCGCCTAAGGTCTTAGACCTCCAATCAATCCAT
GGCTCATGGCGTTCCAGCCATGCCATGCCCAGGATGAGATCATATCTCGAATCCAGGTCAAGGACCAGACAGCGTTCAACGCTATCGAAGTCCAGAAACT
TCACGCCAAGGTTCACAGGAACCTTGGGCACCGTAACGCGGGTTCCCGTCGCGAGACGGACAGTGATAATATCACTCGTACGCGCTACCAGCGCCTCGGC
ATACTGCCGACTTCCTTCCATCGTGGAGCGTCGAGCATAATTGCCCGACGCTCCCGAATCGATCAATATCGTCCACGG