Description :
From Genome Similarity Track
Location :
Scaffold_129:25978- 29254
Transcript NameFunction/comments
Hyaar_Emoy2810533isoleucyl-tRNA synthetase

Sequence
3276 bases(100 bases per row)
TTCCCTGCGGTACGTGTTACCGCGCTCGGGGCACTGCAATCATATGTGTAATGCCCTGTCTTCTGACATCTATTGCATTTCTGCAATTTCTTATAGTTGT
TAACACGAGAGCTCTCGCTCCTCGTGTTACAGAGGTCCATTGGATCTGGGCTTCCATTTTCCTGTCGTCTCGATGGACGATAGGAATTCGAACTCGCGTG
AGCCTGTTTCATGCTGAAGCCCTCCTGTTCCGCAACCCTTATTGCCTCTCCTAGGGTGTTGAACTCCAATCGGAGCAGGTAGATTTTAACAGGACCATCA
GTCAGACCCTGCATGAACAACGTAATCAACGTTTGTTGGTTCAGTGGGTCGACTGTTGTGCAACTGGTAAGGTGACGTATGTACTGAATGTACGAGTGTA
CGTCACGTTTACCTTGCTTGATTCTCAGGAGTTCAGAGTGAGCCCTGAACTCCCCTCGAGGCGGCTCAAAAGTTTGCCTTAGCAGGGACTTGAAGACTTC
CAACGACCCAAAGACATATGGATCGTGTAATATAAGACCCAAGGCCCACGTCTTTGCACGCCCTGCCAAGTTCGATTGAGCAAATGCGATCTGCATTTCC
TCATCGACGATATGACGAGCCCTTATGGCATCGTCTAGTTCCACGAACCATCTCAATAGAGAGTCTTCATCGGCTCCCTTGTACTTTGAGATGTCAATCT
TTAGAGTCTTGGGTCGACGTATACACGTCGACCCGGTAGCAGTGGTCTGCTGCTGTCTCAACAGTTCAAACTGTTGACAACCTTGTTGGTGAAGCAAGGT
TACTTTTTCCCGCTCGGCGTCAAGTTCATTCCGAATGAACTTGGCGATGGTGGCGTGCTGTCCGTCTGGCCCCAGGGCGGACAGCAGTGCGCCAACGGCT
TCTTGCCCTATCGTTGAACTCAAGCGTTCGACAGCATCCCATTCGATTTGACTCAAATGGGAGTAGCTTTCATGCGTGGGATGAAAATCATCCCCCTCAT
CGTCCAATATGTTCATGGTCGTTGAACGGACTACGAAGTGCTACCAGGTGTAACGGGGCACACCTTATTCAAGTAACTGAATAAACCTTGCACTGCTGAC
AGTGCAGGGGCGTGTGCTTCCGACTACCTCACGTACACGTACGTGCAGAGGAAGATTGCTATACGGAGTAAGAGTACTCAGTAAAGGTAAAAAGTAGAAC
TGTATTTAGTATAGTTAATCCTTGTAATAGATCCCTATTTGACTTCATTTAACTATGTCTAAATACAAATGTGTATTATAACTATCTGCGCGCCACTCGT
TGCGTGCTTCTGTCGTGGCTAGACTTTATTGGTTGATATCTTGATCCTTTATCAACCAATGAACAGTGTGTTACATCTGCGGGGCAATATTATCTATTAG
GATAATATTGTGAGAAAATTGTGTTTGTCCTAACGCAATATTCGTACTTGATATTTACCCTAAGTAAATTATCATGTAACGGAGGCACCCCGTTACACTC
ACTGCAGATTGAGGAATGGAAGGGAAAAAATTAGTAGAATGATTTAGCGTGGTACACATTAATTCCGTGCTGAAGTGGTGCTGGTTTTGCGACTGGTGCC
GGTATTGCGACTTTTGCATCTGGTTAGTGCCGGCATTGCGACTTACTCGCTGATTGGTTATGACTGCTATAGGTCTTGTGGATACGCTCGTTTGCACTTC
AAGTTGGTATAGTATGTAAGCAGGCTTTACACGAGCAGTACCGGATATCTGTCATTCGTGACAAGATTTGGACAATGAGGTGGCTCTGTGCTTGATCACC
ACACTGCTATTGCTTTTCCTTGTCATACCCTTTTACCACAACCATACCATGTGCCACGACGAAGTCTTGAGACCTGAGATGCTTCACATTTTGCTCTATT
ACGATCGCATCTCCATGTGCGAGCTCGCCGCTGCTTTTCACCTGCACTACCTCTCGTCAATCAGTGCCTTGGCCAGGTCAGTGATGCTGCGGAAGTCCGT
GACCTTGGCACATCGCAAACACAATTGCGTCCCCTCAATATCCACTTCAGGTGCGTATTTCCAGCATCGCGGACACTTGTGCCCCTCGGCCGGGGTCAGC
ACCAGCTTCACGTCGATCGGGGCATCGCTCGAGACCATTGCCAATTGACAAGTTGCCTCGAACTGCTCTGCACTCTCGATTGCAGCTTCCGAGTCCACGA
CTTTCACGCTAGAGCACAAAAACACATCCTCGAGCTCGGAGGAGCTGGTCTCGAGCGGAGACAGCAGTGCTGCAAGACGTGGATCAGACTCAGACACAAC
AACATAGACGTTGCACTGGAGCTGACTGCCAACTCGACCTGCCTGGCGCATCCGCTCCACCACTCGATTCACTTCAAAGCGCAGCTGACGGATCGCAGTC
CAGTCCCGCGACAATTCGTTGTTCTTCCACTCGTCGGCACTCGGCATCCAGCCTTCATCCAGAAACACACTGCCGACCACGTCTTCTAGTGAGATATCGC
CTTGCAGCCTTGACAGCCAATGAAGGCGGATATCTTCAGCTGTGTGTGGCGCCACGGGTGCAAGAGCACGGGTAAGCGCTTGCAAAGAAAGCCACAATAC
GGTCTGAGCAGAGCGTCGAGTCTGGGAGTTGGCTGCGTCGCAGTACAGGCGGTCCTTGGCGGCTTCCATGTAGAAAGCTGACAGATCCGTCGAGGTGAAG
TGCGAGAGGGCGTGCTGGGCACGATTGAATGCATACGCATCGTATGCTGCGCTCACTGATAGAGCCAGCAAGTTGAGCTCATGCAGCATGTACCGATCCA
GCGATGACTGCATTTTATCGTGCGGGACAGCGTGCAACGCGGGATCGAAATCCTGTAAATTACCAAGCAAAAATCGAGCCGTGTTGCGCACCTTACGCAG
CGCGTCACTTGCCTTACCAACGACTGCAGGACCGATGCTCACGTCGCTAGTGTAGTCAGTAGTGGCCACCCAGAAGCGAAGTACGTCAGCACCGTATGCA
GGTACCTTTTTCTGCTTCACTTTCATGGCCCTATGCAATTTGTTGCTCTCATTTTCCAGGTTCGTCTTCTTGTTAAATCCCTTGTCAGCGACGGGCACTG
GCATAGTACAGCCATTGATAAAATCGTTGGGCACGATTGTATTGCCCAGTGACTTGGACATTTTACTGCCCCGCTCATCCAGAGCAAAGCCATGAGTGAT
GACGTTCTTGTACGGAGCCGTTCCCTGCATCGCTAGTGACGTGAGTAGCGATGACTGGAACCAACCTCTGTGTTGG