Description :
From Genome Similarity Track
Location :
Scaffold_1:2597719- 2599388
Transcript NameFunction/comments
Aphas_H257_00916transmembrane protein putative

Sequence
1669 bases(100 bases per row)
AGCGCGTGTCGTACATCCAATCGAACACGGCCAAAGATGATAATGGGTACGTCGAAGCGAAATCACCCAAGGGCCTGGAAGAGGGGGCGCTGGCTGAAGG
GGGTGCGATAAACTTGTTCTCCCGCGAAGCGATTGCCCTGTTCATACAGTACGGCGCCATCGGGATCATCTACAACTTAATCCCCGCGCTCCGTTATCCC
ATCTTCAACAACTACCTCAACTTGGAGGGTTACCAAACGTCGTCGTACTCGGTGTTGATACACATCGGGTGGTCGTTCAAGGTCTTTTTTGGCGTGTTGT
CGGATTGTGTCCCCATCTATGGCTACCGTCGTAAGTCGTGGATTTTGATCGGGTGGACCATCACAATGATCTGTCTGAGTGTGATGGCGTTTTCGCCGTT
CGGCGAACCATTTTGCAACCGCGAAAAGACCAAGCATTGTGGTACGCCGTTGGAAGAGGTGCCAGAACCCGAGCTGCAGTACTTCAACTTATCCGCCCCC
GACAACGGCACGCTGTACATCCTTCTGTCCATGTTTATAGCGTTTGGGTACGTCTTGGCAGCGAGTGCGTCGGACGCGATGGTGGTCGAGTACGCCCAGC
GAGAACCCATTGCCCTCCGCGGCCGCATCCAGACCGCTATCTACACCGTGCGCACGCTCACTGGCATCCTCGCTTACTTGGTGAGTGCGTTCGGGCTGAA
CGGCACCAACTACGGCGGGTCATTTTCGTTTGCGTTGTCGCCGAATGCTCCGTACGGCATTGCCTTGGCGCCGTGTCTTCTGGTGGTGCTCTCCACATTA
TTTGTTCTCGTGGAGAAGAAGTCTGAGTCTGTGTCCTTCCCCCTATGGTGGGGCAAGTTTTGGGAATCTCTCCAGAGTCGCGTGATGTGGCAAGTTTGTT
TGTTCCGATTCCTCAGCAACGTGTTCAATGGCGTCAAAACCACTGCGACATTACCCATTCAGATGCACTGGGCGGGGGTCGAACCTCTCAACGATGCGCT
CTCTGACATCTTTGGCAATATGGTGTATGCTTCTGTTTTGGTGATTGTGGCCAAATGGGGGCTTCACTGGAATTGGCGCTGGACCATCGCAGCTGGTACC
CTCGGGATGGTACTCGTCGATGGCTTTGTCGTATTCTTCACCATCTGGGACGTCGTGCGTAACCAGTGGTTCTTCAATGGAGTGGGGCTGGCCGAGGAAT
TTCCCCGTGGCCTCCGCTTTATCGTGGCCACGTATGTGGCCGTGGAAATCGCCGATAAGGGCAACGAAGGCGCCACGTACGGCCTGATCTCCACTGTGAG
CAATCTCTCGGGGCCCTTTGCCAGCATATTTTATAAGTACGTCAACTCGTACTTCAAAGTACGTCAGAATGACGTCAAGTCCGACACGCTCGAGGTGCGG
TTGGACGTCACGTACGTCTACTTTATTTCGTATGGGTCCAAGATCGCGTCGTTGTTTTGGCTGTTCTTGCTGCCTCCCCAAAAGGCAGAAGTGAAGTTCC
TGAAGGAGCGCGGTGGCAAGAGCAAATTGGCGGGGTTCATTCTCGTGTCCTTGTTTTTCTTCTGCATGGCGTTCACCGTGTCCAGCAACATCATGTCCAT
CTTCCCTTCCACCAAGTGCTACCGTATCGCAGGGGGCAACGGAGTGTTGGACCCCAACACGGGCAAGTG