Description :
From Genome Similarity Track
Location :
Scaffold_129:25977- 29258
Transcript NameFunction/comments
Hyaar_Emoy2810533isoleucyl-tRNA synthetase

Sequence
3281 bases(100 bases per row)
GTTCCCTGCGGTACGTGTTACCGCGCTCGGGGCACTGCAATCATATGTGTAATGCCCTGTCTTCTGACATCTATTGCATTTCTGCAATTTCTTATAGTTG
TTAACACGAGAGCTCTCGCTCCTCGTGTTACAGAGGTCCATTGGATCTGGGCTTCCATTTTCCTGTCGTCTCGATGGACGATAGGAATTCGAACTCGCGT
GAGCCTGTTTCATGCTGAAGCCCTCCTGTTCCGCAACCCTTATTGCCTCTCCTAGGGTGTTGAACTCCAATCGGAGCAGGTAGATTTTAACAGGACCATC
AGTCAGACCCTGCATGAACAACGTAATCAACGTTTGTTGGTTCAGTGGGTCGACTGTTGTGCAACTGGTAAGGTGACGTATGTACTGAATGTACGAGTGT
ACGTCACGTTTACCTTGCTTGATTCTCAGGAGTTCAGAGTGAGCCCTGAACTCCCCTCGAGGCGGCTCAAAAGTTTGCCTTAGCAGGGACTTGAAGACTT
CCAACGACCCAAAGACATATGGATCGTGTAATATAAGACCCAAGGCCCACGTCTTTGCACGCCCTGCCAAGTTCGATTGAGCAAATGCGATCTGCATTTC
CTCATCGACGATATGACGAGCCCTTATGGCATCGTCTAGTTCCACGAACCATCTCAATAGAGAGTCTTCATCGGCTCCCTTGTACTTTGAGATGTCAATC
TTTAGAGTCTTGGGTCGACGTATACACGTCGACCCGGTAGCAGTGGTCTGCTGCTGTCTCAACAGTTCAAACTGTTGACAACCTTGTTGGTGAAGCAAGG
TTACTTTTTCCCGCTCGGCGTCAAGTTCATTCCGAATGAACTTGGCGATGGTGGCGTGCTGTCCGTCTGGCCCCAGGGCGGACAGCAGTGCGCCAACGGC
TTCTTGCCCTATCGTTGAACTCAAGCGTTCGACAGCATCCCATTCGATTTGACTCAAATGGGAGTAGCTTTCATGCGTGGGATGAAAATCATCCCCCTCA
TCGTCCAATATGTTCATGGTCGTTGAACGGACTACGAAGTGCTACCAGGTGTAACGGGGCACACCTTATTCAAGTAACTGAATAAACCTTGCACTGCTGA
CAGTGCAGGGGCGTGTGCTTCCGACTACCTCACGTACACGTACGTGCAGAGGAAGATTGCTATACGGAGTAAGAGTACTCAGTAAAGGTAAAAAGTAGAA
CTGTATTTAGTATAGTTAATCCTTGTAATAGATCCCTATTTGACTTCATTTAACTATGTCTAAATACAAATGTGTATTATAACTATCTGCGCGCCACTCG
TTGCGTGCTTCTGTCGTGGCTAGACTTTATTGGTTGATATCTTGATCCTTTATCAACCAATGAACAGTGTGTTACATCTGCGGGGCAATATTATCTATTA
GGATAATATTGTGAGAAAATTGTGTTTGTCCTAACGCAATATTCGTACTTGATATTTACCCTAAGTAAATTATCATGTAACGGAGGCACCCCGTTACACT
CACTGCAGATTGAGGAATGGAAGGGAAAAAATTAGTAGAATGATTTAGCGTGGTACACATTAATTCCGTGCTGAAGTGGTGCTGGTTTTGCGACTGGTGC
CGGTATTGCGACTTTTGCATCTGGTTAGTGCCGGCATTGCGACTTACTCGCTGATTGGTTATGACTGCTATAGGTCTTGTGGATACGCTCGTTTGCACTT
CAAGTTGGTATAGTATGTAAGCAGGCTTTACACGAGCAGTACCGGATATCTGTCATTCGTGACAAGATTTGGACAATGAGGTGGCTCTGTGCTTGATCAC
CACACTGCTATTGCTTTTCCTTGTCATACCCTTTTACCACAACCATACCATGTGCCACGACGAAGTCTTGAGACCTGAGATGCTTCACATTTTGCTCTAT
TACGATCGCATCTCCATGTGCGAGCTCGCCGCTGCTTTTCACCTGCACTACCTCTCGTCAATCAGTGCCTTGGCCAGGTCAGTGATGCTGCGGAAGTCCG
TGACCTTGGCACATCGCAAACACAATTGCGTCCCCTCAATATCCACTTCAGGTGCGTATTTCCAGCATCGCGGACACTTGTGCCCCTCGGCCGGGGTCAG
CACCAGCTTCACGTCGATCGGGGCATCGCTCGAGACCATTGCCAATTGACAAGTTGCCTCGAACTGCTCTGCACTCTCGATTGCAGCTTCCGAGTCCACG
ACTTTCACGCTAGAGCACAAAAACACATCCTCGAGCTCGGAGGAGCTGGTCTCGAGCGGAGACAGCAGTGCTGCAAGACGTGGATCAGACTCAGACACAA
CAACATAGACGTTGCACTGGAGCTGACTGCCAACTCGACCTGCCTGGCGCATCCGCTCCACCACTCGATTCACTTCAAAGCGCAGCTGACGGATCGCAGT
CCAGTCCCGCGACAATTCGTTGTTCTTCCACTCGTCGGCACTCGGCATCCAGCCTTCATCCAGAAACACACTGCCGACCACGTCTTCTAGTGAGATATCG
CCTTGCAGCCTTGACAGCCAATGAAGGCGGATATCTTCAGCTGTGTGTGGCGCCACGGGTGCAAGAGCACGGGTAAGCGCTTGCAAAGAAAGCCACAATA
CGGTCTGAGCAGAGCGTCGAGTCTGGGAGTTGGCTGCGTCGCAGTACAGGCGGTCCTTGGCGGCTTCCATGTAGAAAGCTGACAGATCCGTCGAGGTGAA
GTGCGAGAGGGCGTGCTGGGCACGATTGAATGCATACGCATCGTATGCTGCGCTCACTGATAGAGCCAGCAAGTTGAGCTCATGCAGCATGTACCGATCC
AGCGATGACTGCATTTTATCGTGCGGGACAGCGTGCAACGCGGGATCGAAATCCTGTAAATTACCAAGCAAAAATCGAGCCGTGTTGCGCACCTTACGCA
GCGCGTCACTTGCCTTACCAACGACTGCAGGACCGATGCTCACGTCGCTAGTGTAGTCAGTAGTGGCCACCCAGAAGCGAAGTACGTCAGCACCGTATGC
AGGTACCTTTTTCTGCTTCACTTTCATGGCCCTATGCAATTTGTTGCTCTCATTTTCCAGGTTCGTCTTCTTGTTAAATCCCTTGTCAGCGACGGGCACT
GGCATAGTACAGCCATTGATAAAATCGTTGGGCACGATTGTATTGCCCAGTGACTTGGACATTTTACTGCCCCGCTCATCCAGAGCAAAGCCATGAGTGA
TGACGTTCTTGTACGGAGCCGTTCCCTGCATCGCTAGTGACGTGAGTAGCGATGACTGGAACCAACCTCTGTGTTGGTCGG