Description :
From Genome Similarity Track
Location :
Scaffold_26:259720- 264812
Sequence
5092 bases(100 bases per row)
ACGCTGGACTATGTTATGTGCCAGCTGCTTGCAACGTTTAAGACGACTATAACGGCTAGCCAGGCGATGAAGCTGTTCATGCAGAAGAAAGATTCCAAGC
GCACCTGGGCAGAGCACTATCTCTACATGGTTGCGGTAAGTGACGCGCGTGGAGGTGCCGAATCGCTTGTCTTAAATAACATCGTACACCACGCGTCGCC
TGAGCTGATGAACGTCATGCTGGCCAAGTACGACCCGACGCGTGTCGACTACCTACGACATGCAGAAGATCTGGCGCATTTTGCCCAGTCGATCGAGCTC
GGCAGCGGGGCAATTGGATGCGAAGTCATCGCTGCTCATGTCGACTCGAAGAGACACGCGCATCTGCTACGCATGCGGCACAGTGGGTCACGTAAAGCTG
ACTGTCGGTCGAAGGGTAAAAGAAGAAGCGGAAGTCTGTAGGACGACAGCGCAGATGGTCGTATGGTGCTCGCACTACGCGAATCGAAAATGAAGGAGCG
ATCAAAGAAACCGAATCGCAGCAGGAAGATCAAGCGGGAGATGGTACTTGCAGTGAGCGACTCGGATGGCTGCGATGGAAGCGACTGGATACTCGACAGC
GGCGCAAGTCGACATCTCGTGAACGGCGAGAAGTTGCTTAACGACTCGACTGCCTGCAGCCGCGAGATCGCTATGGCTTATGGAAATACCCTGCACCTGA
CGCGAGTCACCAGCGTGCGTCTAGAAGTCATAGCTCGCGGCGTGGAGAGCATTGTTACGCTTACGGATGTGTATATGGCGCCGAGACTGGAGAAAAACAT
CGTCTCGTACGGCAAGCTGGAAAGTAAGGAGTTTGCTCTTACTTACGATAGGAAGAGGCGCGCGTTCGCTCGGCGCAGCGACGGTGCCGTCGCGTTCGAC
ATTGTGATGAAAAGCAACGTTTTATACGTAAAGGTGTCAGCGAAAAAGGAGAGACAGAGAGCAGGCGACACCATCATGGCTGCTCTCGAATTAGGTGCGA
GCGCAGATGTTGCGAGCGATGTGCAAGAAGGCACGCTGTTACACTTTCATCAGCGATTTGGGCCTCTGGCGTTTGACACCATCGAGCTTATGGCTCGGGA
CCCAGCCTCCGGGATAAGACTAACGAGCAACAAGCGTATGGCGTGTGTCTCGTGCATGGAGGGTAAGCAGACGCGCAACATCCAAACCAGGAGGAGAGTG
GCACCAACGCGCCTATCGATAGAGTCGGCGGAACCATCTGTTCGGATTTGAAAGGTCCGATGACGCCGCGGGATAGGCTCGGAAACCGATATTTGGTTAA
TTTTGGCGACCACAAATCGAATTACAGCCGAATTTTTCTCGCGCGGACGAAGGACGTAGCGGCTAAGCAGTTAGAGGCCTTCCTCGTCTTCTTCGAAAAA
CGATTCAACTGCCGAATTTACGTGCTGAGGACTGACGGCGGTGCAGAGTACGCCAACGTCGACCTCTTTTGCAAGAAGACTGGGGTAACAAGGCAAGTGT
CAGAAGCAGGAAATCAGGCTTCCAATGGCAAGGCAGAGCGCATGCATAGGACGGTGCTAAATTTGACGCGGAGCATGATGTTTGCGTGCGGACTACCACT
ACACTTCTGGGGAGATGCGGTTCAGTACGTATCGTATATACTGAATCGCAGCCCTACGCGCGCAAACGTGAAGCGAGCGTCGCCGCTAGAAGTGTTGAAC
GGTGCCGGATCTGCGTAAGATCGTCGTATTCGGTTCTACCTGTAGCGTGTATCGCGACCCAAGGAAGAATTCGCTGAAACAACGCGCGCAGCTTGCTACA
ATTGTCGGGATAAACGAGGAAACCAAGGGTTACAAGGTTTATGCAAGGAGAACAAGGTAATAGTAACGCAGCATGTCAAGAACATCGACACGCTGTCCAA
AGCACAGAACGCGCAGCTTCAGAGAGCGATGGTCGATGAGGACGAGGATGTTGCTGCACCCGACTCAAGATTAGCAACGACAATCGACACAAGCAATGTC
ACCAGCATTAAATCCCGGAAGAAGAACAAGAAGAAATGAGCAAGGGCTGCACAAGGCACGCGCGGTGCCTCGAAGCGTGCGCAGGCATCGCACTTCAGGA
GGAGTCGAGCGGTGGTGTGGTGAATGCTACTTTAGAAAAGGATCCGACTAACTACAGTGAAGCCATGTGTAGCAACAAACGCCACGGATGGGTCAAGGCG
ATGGAAGAAGAAGTAGAGGCACTTTAAAAGAATAAAGTATGGCAGGTGGTCAAGCGTGCGCCTGGCTCTAACGCCTTGCATACCAAGTGGGTATTCAAGA
CCAATACTGACGCGCAGGGCAAGATTGCACGATTGAAGGTGCGCCTCGTTGCCTGCGGCAACCAACAAGTGCTGGGAGTCGACTACAGCCTCACATTCGC
TGCAGTCATGGACTTGACAACTGTGAAGATTATACTGGCGCTTGCTGCTACGTGGGGAGTGACTGCCAATCACGGCGACATCCCCAACGCGTATGTCAAG
GCAGGTAACAACGAGCACCTACAAATTTATTTACATGTGCCGGGCGGGATGAGAATATCAGAAGAAACTGTGCGTGAACAAGGCGTAAAGGGTGCGGAGG
AGCTTGTCCTGGAGCTTAGGAAGAGTCTCTATGAACTGAAGCTGGCTGGTCGACTATGGAGCCAGCTTCTGCACGAGCGTCTTGTCGAGGCAGGATTCAA
GCACTGTGAAAGTGATATGTGTTTTTACTGGATGAACGAAGGAGAAGATCTCGTCGTCGTGGGCGTCTATGTGGACGACCTTTTAGTGACCGGAACGAGT
GCAGATAGAGTCGACCGACTTTTTAAAAGCCTCGCGTCACTATCGATTAAAGATCTCGGATACGTCAGCAAATTTATTGGGATGCGGATTGAGCTTAATG
GTACAGGCGGATACAACCTGGACCAGGAGGAGGCGATTGGTGATCTTTTGCGGACCAATGGGTCAGCAGAAGCAAATTCGACACGCGCTCCGATTGGCGA
TGATTGCTACGATGCGCCATATGATGATGTGGAGCTGCTTGGATCGACAAGCACGGGCAGTGGCCCAAGGTACGCGATTTTCAATCGCTGGTCGGCAGTT
TGCTCTGGATTACGCGCTGTACGCGACCCGACATCGCATTCGCGGTACACAAGGTTACATGACAGACACACGCGCCGCGTATGTTCGACTGGAAACTCGC
TAAATGGATTTCTCGATACTTAAAAGGCACAACATTTTTGAAGATTACAATGACGCCGGCTCAAGAAAAATACTGTCAAGAACTGCAACTGGAAGCATTC
AGCGATGCTGACTTTGCGGGAGACTAGGCCGAGAGGAAGTATATCACCGGCGGCGTGCTGCGTTTGAATGGGATGGCGGTGAGCTGGGGAGCTCGCAAAC
AGGGAGGAGTATCTCTGTCGACTATGGAAGCCGAGTTTGTTGCCGCTTTCGAGATGGCACGCGAGTTGCTCGGACTGCGTGAGATGCTCAGCGAGGTTGG
CATGGCACTGGCATTGCCAATGAAGCTTTATGTCGACAACCAAGCGGCCATCAGTCAAATTTCGGGTGAAGCATCATCGGTGAATGCCAAGCACATCGAT
GTTCGACTTACTTATTCGACTTAAGTTCTTATGTTCGCGCCGCGGTGTGATCGCTGCGTGCTACCTGAGGTCGGAGATGATGCTTGCGGATCTAATGACG
AAGGCTCATGATGCTACGAAGCTCGCATCGCTTCGTGGTTTACCATGCATCGGCTAGAGGAAAGGAATGGAAGGCGCACTCGAGGAGGAGTGTTAGAAGT
TAAGGATTATTGAGGTGGAAGCTGCGATTAGCGCCAGACATCATTTGCCGCATGCATAGTGAATGGGAGTAGTTAGTGCTAGCGACCAACCGATTTGAAA
CGGTTGGAGCAGAGAGGGTAAGGTGAAAGAGTAACTCACGGAAGAGTAATTCATCTTAATTCAGAATCTTATCATCCCTTTCCCTAAGTAGTGTGTATTG
TCAACAGGTATTGTGTTGTGTGACTCCATTTGTAAAGGGGTTACGCATCGTAGGGTACTCGGTACCCTATGTCTTAGACACACGGGATGGTATCCCACTG
AAAGAGATATAGAATATCTTATCGGTTTATAGGGGCTGGCGGTGTCAGCCACAAGATAGGAAAGATCTTAAAGATATTAATTAGGACATGAGTGCCTAAA
TTACGTAATATTAGGATTAAGATATTCTATAGAGTTAAACATAAATAAAGTTCAGTTCCCCTTTTGATCTTGTCTAAGACACGTGCCTTGCGAGGCGTCT
CTGATCGTTGATCGTTAAGAGTTAGCAACATCTCCCTTAGGTAGCTACTCTTGAACACTAAGTGTTGTAGGTTCGCTGAATCGTTCGGTACCCTGGCAGG
GACCTTAAGCTTTACGCTTGTTGACTCATAGAGTCTAGTTCTTTAGAACTAATATCGCTCCTTGAGCACTAAGTCTTCCTCTGACTTAAAGAGCTGTGTA
GCTCCGCTACACCATTTGTCATAGTCAAATCCGGGGCAAGTATGTCATGAGCGATTTGAAGCTTTTGCCGGGATCGCAGACATATGCTGGTCCCTTGATG
TTGTACTCCACGGAAAACCTGTTCATAGGCAGATTTGATCTTGTCATGGCAAATCTATTGCCAGAACAAGGTATTTTGAGATTCCTCAGCATCATGTCAA
TGAAGTAGGAGCTAAAAGTGATTGTGGATCAATGTTAGCCACCATGCGTACCGGTGCTACATCGTCGATTCTTCTCTGTGGTCGGTTTAAAGTGCTATTG
AAGCTACCAGCTGGACATATTAGCCGATTGTTGCCTATCCCGCGTTCGTTCCTTAGTCATGCACAGTAATGTGACAGAACCAAAATCCCATTAGATTCTC
ATTATATTTGAAAACAGCAAGAATAAGTGTTGTGATTCTATTATTGTCGAAGTAACGCTAGAGTGACGGTCACGAGTTCAGCTGTTACGAGCCGGTAGAA
AGTCGCTGTTACCAACCAGTAGAAAATGGTTGTTACGATACAGTAGACAATCTGGTAATCGATAGAGTTAGAGATAGCCATATAGTTTGCGA