Description :
From Genome Similarity Track
Location :
Scaffold_13:259713- 262899
Transcript NameFunction/comments
Physo_130860hypothetical protein

Sequence
3186 bases(100 bases per row)
TGCAGGTTACATCAGATGCTACAGTCAAGTGCGATAAAAACATTTTGGACAGTGCTACTGCCCATGTTTAGTGTCCAGGTTGAGCCCATGTTTTGGTTTT
TCTATGGACCTCGGCCCATGTATTGCCCACTCCAAATGGGACGACTCCTCTCATCTGCGCTTCTAGGAAAGGGTTGGTGGATATCGTTCGACTCATTGCT
ACACCTTTCTTCCAAGCTGACAGCAGTGTAAAGCAAAACGACCTCAACTTGTACTTGGCTTGTCATTTCCTACTTTCAAGTATACGTGTACTGTACCTTC
AAGAAAGAGTATTTTGCCGCACTCACTAACAATCTCTTTGTCTTTCAGTTCCTACGCAGCTGCCACCTGTCTACCTACTCCTCTTTTCGCTCTAATTGAG
TGGCCGATCGACTTCACCTTCGCCAATGCTTGCACACTCTCCATCGTCATCTTTGGCAGCTTTGCAGGCTCCTTCACACCAACACCAATGTCACTCAAAT
CGTCCGCGATCTCCTCCTTCATCTCCTGCAGCCGCTCCTGGAACCGCTCCTCCTCCGCGAAGCCTCTGATCACCTCGATCGCGTCCGCAAACTTCATGCG
CTCAGACGGCTCAAACGCGCACAAACGGAGTACCAATTCCCACTGCGCGTCGCTCTCGAACGTCTTCGGACGAGGCATGAACTTCTTCCGCGTCACATGG
AACTTCACCACCGGGTCAGACACTTGCTGCCCCCACGGCACGTCACAAGTCACGGCCTCCACCACGCACATGCCGAACGAGTACACGTCCGACTGCGCGT
TGGGCGCCACGGGTTTGTCCTTGCGGATGACCTCGGGCGCCTTCCAGCGGATGGCTCCGACCGTCTCCTCGTCTCCGCTCTGCTCCGTGGCCAGGAAGCT
CAGGCCGAAGTCCGTCAGCATGGTCACGCCGTCCTTGCTCACGAGGATCTGGTTGCACTTGAGGTCGCTGTGCACGATGTGTCTCTCGTGCAGGAAGTGC
AGGCCGAGAGCGGCGTCCAGCAACTTCCGCCACACCAACGATCGACCTTCTTCTCTTGCGTGGTATAGATAATCAAGCAGCTTGCCGTTCTTGGCCTCCT
CGCACACGAAGAAGTACGTCGAGCCTTCGTCACAGGCGCCGAAGAACGGCACGATGTTCGGATGCCTCGCTTTCTGCCAGATACGCGCTTCTCGGTGGAA
GGTGCGGCTCTCCTTTTCGTTGGCGACGGTGACGGTCTTGACTACGACTCGAGTACTGAGCCACCAACCTCTGTAGACTTGACCGAAGGATCCGGCGGAG
AAGGGCTGTTGGTCTTTGCGGACTTCTCGACTGGGAATGAACCAGTCCGGTTTCTCCCGCTTCAGAGTGACGACATTGCCTCGGTCATTGCCAGGCGGAA
CAGCCCGTTCCGCCTGGTGACGTTGTAGGATCCGCATTACCTTGTTTCTGCAGTTGAAGCGAGCGATACCGGTAGCAGTGCGGCCAGAAGTGTCCTTAAG
ATAAACGTCGGTATCGTTGTCTAAGAGAATCTCGACAATTTCGTCGTGACCTCGGTAGGCGGCCTTCATCAACGGGGTTTGGTTCTCTGAATCCACAATA
TTTACAGCTGCACCTTTATCCAAGAGAGCACGAACGATGTCAAGATGCCCCTCTTCCGCCGCAAGGAACAGCCCCGTGCGTCCGTCACTCGTCTTCGAGT
CAACCGCGGCACCCTTTTCCAGCAAGAAGTTAGAGATCTCCACGCGTCCTCGTTGAGCCGCTCCAACGAGAGGCGTCCACCCAACGCCATTTTCAGCGTT
GATATCGGCTCCATGGTCCAGTAGAAAGCGCGTTCCCTCGCGTTTGTCTTGGTAAATGGTCTCATGGAGTGCAGTGTCTCCGTCATTATCCCGAAGGTTT
ACGTCCGCACCTCGGGAGATCAAAAGTTTGGCCATCTCGATGTTACCGGCCCCCACAGCAATCTGGACAGCTGAACAATTGTTGTTTCCTGGCATGTTGA
CGGCTGCTCCATTGTCCAGAAGCAACGATGCACACTCTGTGTTCTTCTGTCTCGCCGCGAAGTGGAGCGCGGCGGCACCATCTTCCGCCTGAGCATTAAC
ATCGGCGCCAGCTTTTAGAAGCTGGTTGATGATACCCACCGCCTCGCTCTTAGCTGCCAGTATCAACGGGGTCTGCCCGTACGAGTCTGGTATGTTCACA
TTGGCGCCGTGTTCGATGAGAGCGAGGGCTGCATCGTTATGCCCGAACGTTATCGCGATCACGAGAGGGGTCGATCCATCCGTTGGTGTAGCGTCGATGT
TCACTCCACTCTCCAGTAGAGAGGTTACGACTGCAGTGTGGCCATTCTCCGCCGCACAACCTAGAGCAGTGAAGCCGATATTGTCCATTTTACTGCTGTC
AGCCCCCTTTTCCAGCAAAAGGTTCACGATATCAATATAACCGAACAACGACGCTCGCATCAGAGGGGTACACCCTTCGTTCGTAGTGCGGTTGATGTCC
GCGCCGCTCTTCTTCGTCGGCCTTGTTCAAGTCGGCGCCTCTCTTAATCAGGAGTCGAGCGACGTCGAGGTGGTCGTGCTCAGCAGCGAAATGCAGCGGA
GACCTGCGAGCTTCATCGGTGACGTTCACGTTAACGTCCCTCTGCAGCAAAAGCGTCTTCAAGACGTCGAGATCTCCGTCTCTTGCAGCTGCAAAGAGAG
ATTCCTCTGCGTTCTGCTCGCTCATGCTTGTCGTGGCAAGGTGGTGTCTTCCGAAATGAGAGAGGCTCGAGCCATTCCATTCCCACAATAATGGATACCT
TCGCGCGTGTCTTTTGTGGTCTTCAATGAATGGCTACAACGAGTGACCGGAGGTCATTGGAAGATTTTTAAATGGGTCTTATGCAGAACAGGTCTTGGTT
TTGATCATAGCGTACTTTTTCTATGATCTCGTGATTGGATCACATTCGCCATGTTTTGACGACAAAAGCCACTTCACCGTAGACTACGAACGCCCTCGAG
CTCACCGCAGTGGCTGCAATGGCGCTGGTGGGTACCGGTATCACCAAGTTGCGAGCAGCTAGGTGATGCGGGGTCTTCCAGCCCTGATCGTCCAACCCGC
TATGGACCGAGCCTCCTCTCCACCCAGGCTGGCAGAGCGAGCTGCTGGACATGGAGCTGGAAGATACAGCAGCAGGCCACGGCACG