Description :
From Genome Similarity Track
Location :
Scaffold_1234:2597- 6694
Transcript NameFunction/comments
g15843.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569
g15844.t1hypothetical protein
g15845.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
4097 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATGCACTAAGGAATACATTCAGGTGACCACTCCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAA
GTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCGATGGCAGAACCTCTCAATATAAATATCAGTTTTAGGAGGAAA
CCCCATTTACAATCAATACAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTTCCTTTATTTAGGTTTAAGTATACTTGCGGATACAAGTATACTGAACT
TAAGTAAATTATTCCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTATAGT
CCGTCCAACGACCGACTAACTACACGTTCGTATGGCATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACA
TCTGCAACGCATGTTGCGCGTGCAGACTACCCCCACCTGTCGGAACCAAAGTGGGAGACCCTCCAACGACTGTCGACAGTCATTGGGGAAGCGGCGGTAG
CAACGATGTTGTGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTC
GCCATCGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGGGAGCCTCTCCTCCGTTGGCTTGTCGAGGTCGAC
ACTGCCATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCC
GACTCACGGACCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGAAGCTCAAGCTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGA
GTTCCTCGATCTGCAACGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACAGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGA
CAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATTGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTG
CAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGCCTGATGCCACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGAACC
AATGGACCTCTCGAGTGCGACAGCTGCTGGTTCCCAGCAGCGTCGTAAATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCTTGC
GAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATCAAAAAACTAGATGGACCAGCAGGCGCGGGGCG
CCCTGCTGGTGATGCGGTCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGAC
AAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGTGCGTTGAACAACTTTGTTCGACTGCAGA
GCCTTCCAAGGCTTGACTTCGAGAAGGTGAAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAAAAGCGTATCAT
ACGCGTACGCTTCTCTTATCAAGAGCAGGAGTTCGTCGACGAGCTTATCGTCCTCGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTT
GCACGGCATGATCCAGTGATCGACTGGACGAAGCGCACGATCGTGCACTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCAC
ATGCACCACGTGGTGCATGCGACCCTCCACTAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGG
AAGAAGATGTGAAACGAATCAGCAGGGCCTGATTCGATCGGATTCGAGAGGGTCTCGATAGATATTGTCGACACACAATTTGTCGAAAGACACTCCGCCG
TTAGGCGTAGATGTAAAGAAGGCGCGTCGGCTCTGGGAGCCGACGCTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCAC
GACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGTCCGCGGGTAGAACCCGCCGGCGAATACAGGGAACAACTGTCCACGGCCGGGCCTGGAC
AAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGCGCAAGTCTCGGTCAGTGACCGAGACGCTACAAGCAGT
GTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACGTTGAATGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGGAG
AATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGTTCGCGAACTGCACGATGGACGCATCAAGTAGATCTGCA
TCCTCTCGGACATCGAGAGGATGACGTGTGAAACAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAACAAGGAACG
CTTCGACGAGCAAGGCTGGGACTCGCTCAAGGGGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGATATTCCTGCGGAGTTA
CCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTATTGCGTTACGCGACAGTGACCACTGCCGCGTGAGCAAGTCAAGGCAA
TCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCAAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGG
GTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATACGACGGTACCGGCACAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCG
AGTACTATCTTCAGTACTCTGGATCTGAGAGACGGTTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACAGCGGTAAGCACTCCGAGCGGCA
TGCTCTGGGAGTGGCTCGTAATGCCGCAGGGACTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGC
ACCGATCTATTTCGACGACGTGCTCATTCACAGCCGGGCTGTGTATGGGAGGTCGGATGTGGAGATGCACACAGAGCATCTCCGCAAGTTGCTTGAGCTC
ATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATATCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCT
CTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTTGCCACGTACTTGTGCAAGTA
CGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGTCTGCATGGAAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCA
GTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCCGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCG
CACTGATGCAACTCGATCACGAAGGTCGAGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGA
ACTCCTTGCCATAAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACGTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACG