Description :
From Genome Similarity Track
Location :
Scaffold_1700:2597- 3808
Sequence
1211 bases(100 bases per row)
GCTCCTCGTGGCCTTGTGGGCGGCCACACTTCTAGGGGCATCTATGAACGAGCCCTTGTTCAGAAAGAACAGTTGTTCGTCGACAACGTGGAGGCTGCTC
GGTGTGTGCTTCTCGCGCCACACCGCATTCCCCTTAAGGACTTCACGACTTGTCGTAAGAAGCCCGAGACCCGGGGTGGTCTCTATCCTGTTTGGGGGAT
TTTGGGGGAAAACCCCCGGGGTTTTGGCCCCCAAAATGGTCCCCCCCGGGAATTTCTGTGTGAGAAAAATGTTCTGGGCCTGGGTGGAGACTCTCAAGTA
CTCGCCCACGGAGTTATGGGAACTCCATGAAGATCAGCAGCTGTTCTACATTCTGGAACAGCGTGATCTTCGTGTGAGGTTTGCCCACTTGATCAGCAAG
CGTATGCTGCCCAGGGACATCCTGAAGCGCGCGGCTTCTAGCGCTCACGATGAGCGCGGGTACGGTATGTATTCATCATCCGTACCCCGTTCGGGCAAGA
AGCCCCGGACTACTTATGAAGCTGCTCGCCGCTTCTGTTCCTCAGATTGCGACAGCCTTCGGGCAGTCAATCAGGAGCCGTCAATCCGGCTCCCACGAGT
TCTCGGAGTGGGCATAACCCCTCCACTTCACGAGGAGCTGTCGCTTCCCGCGACACCGTTGCTCCTGGAGGATCCGCTTCCACGTGGAAGTGGACTCTCC
ATTCCGGTCAAGCAGGGGCGGAGGTGCCCTCGTACGAGTACGAGTACTCGGCGCCTCCCGAGAGACACTCTCGTTCGAGTGCTCCGACTGCGGGTCCGAC
ACGGGACCCTGAGGTTGACCGCCTCCGTCAACGTCTCCTCGTGCTTGAGATTGCACTTGGCCTTGGGACTGGCGGTAATGCTGCCGCCCAGGCCGGGAAT
CAGGGCGAGCTCGCTCGTCTTGCGGGTCGCCTGGACCTGGTGGAGCGAGAGGTCGCGAGCCTGCACCTGCGGGTGGACCGCCGGGCCTCTTCGTCCGATC
TGGACGAGGCCTTTCGCATGATCCGACGGATCGAGGCTTTGTTGCCACGTCCGGAGCCGCCTGCGGCACACTCCCAGACGTACGCGTATGGTGCGTACCC
GGCGTACTCAGCGTACTCGGCGTATGGCGCCGGGGTCCGTTCGTATGGAGCCCCTCCGGCGTACGGTCTTGACCGCAGCCTTGCCGTCCCGACCGAGGCT
TGGGTGCCTGC