Description :
From Genome Similarity Track
Location :
Scaffold_48:25963- 28005
Transcript NameFunction/comments
Phymu_g2615hypothetical protein

Sequence
2042 bases(100 bases per row)
TGGCAAGTAGCAGCAGTTTATGCTTGCTACTCAGTCGGAAATACGCCTCAACCTCATGAACTAAGCCATGCATTCGATAGCAGCCACAGATCAATCTAGG
TAAGCGTAAGGCCATGTGTGTGAACTGCAGTGGTGTAAATATCCAGTACGGCCACGCACAGAAGAGATCCACGAAAAACCTCCCACTGCCCACATAGCGC
TCAGCACTCCGTGTCGGCTCCACAATTTTCTCCGAATTTACTGAAAATGACAAGTGAAGATTCACGTAAATGTCCGTCCAGAGGATAAAATCTGCCAAAA
GGTTCATCAAAATGACATGCCAACTCGCCCACAGTCCATCCAAAGCTGGAAACGAAAGCAATAACGGGATAACGACCCAATTGTAGCAATTCACGGTAGT
TACCATCGCGATCCACAGCATTCTCCAGTTCGATTCAGCATCGAGACCGTTTTTCATAAGCAGACGATGCCACCAACGTTTTCGACAAGTTGTCGATGTG
GAAAGGTGGGCAAACTGATCGTAGAATCCCTGGATCGCGTCGGACGGCTTGACAGCGTTATCGTGGAAGAAGTTGTCCCGTAACAGGGTTAATCGGTTGA
TTCCTGCCGCGAGAAATGACGATCGTTGACTACTGCGTCTTTGTCCAGTGGCTTGAGGAACGACGGGGAAGATTTTCACCGACGTTGGCTTCGATTGCTT
CCGTGATGAGAGGATATTGTCACTTCGAAAACTGTCCCGTTGTACGCTTTGCAGCACTGGCGCTGGCATTGGCAGCGAGTGTCGAGGGGGCTTTACACCT
TTCACTTCGACCGGAAGAGGTCGAATTGCGACTTTTGCCTCCGAATTAGGTTGCTCGAATGGAGCAGAAACTTTAACAGAATCCTTTTGCGCGGAGGGAT
CGTCCATCACTTTCCGGTTGGTTTCTTTTCTTGCATGAGCACGAgcatgcagacgctgcttgAGTCGAACGAGCTGTGCGAAGGATAGAGTCGCATTCTG
TTTTCCCTCCGAGACGCTGTCCCCTACCTCGTTTCTATCAGAAATCGTCTCCACGGCCGTCGGTGGGATCACGCTGCTTTGTCGGAGCATTTCGCCGATT
GTCCGGTTAATCACTTGAGCGTATTGTGGATATCCCTCCAGCAATTTGTCGGCGTGGGCACGGGAGAGCTGATACAAGGTGCAATACGTAGCAGTGATGA
CTGTAGCTGTGCGTGGCTGTCGAGCGAACACTGCGACTTCGCCTACAAAGCTTCCTTTCCTTAGTTCCCGAACTTTAACACCACCCACCACAGTGTGTAA
AACGCCCGTGTGAACAATATACATCGCGTCTCCGTGGTCCCCCGCACGGAAGAGCGCCACCCGTGCCGGCAGTGCGATCAACTCGAGCAGTCGAGCCACC
GCTCGGATAAAGAGCGTGTCACAGCCAGCAAATACGGGCACCAAGGCGACCGtggcttcaagcagctccacctggATATCCACCGAGATCGAAGGGCACA
agcgacgtgctgcttctcggtCGTTGGCTTCCGCTTGAGTGTGATATCTCTGGAGATAGTCAACCGCTTGGGCTTGTAGTTGAACTGGAACTCGGTGGAA
TGCCAAAATGTGTTGAAACTGGTGCACACGCgcctccgccagctccgCGTCGCCGCTTTCGCACTTTGAAAGCAGGAAAAACGTCGCGCACAACGACGTG
AAAAGCGTGAAGCCACAGAGTCCAACGACGATCGTGAACGCGAACTCGGTATTGTGGTGGGGCAGCTCGCCTTCAAAGCCTCCAGTCAGCAGTCCAAAGG
CCCAAAAGAGCGACATTAGGTACTGCCTCCTTTCCGTATGATGCCCTTCATGCGGGGCGTGCGGCAGCCAGTGGTTCGGCTCCTCCCCGGGGCCAGGATG
GTCGTAGCCGAAGCTAAAGCGTCCACAGGCCACAAAAtgggtcagcagcagcgtaaACCCGAGCACTTTCGTGAGCTTGAGCGCGGCGAAATGCCGCGCG
TACAGGTCGTCGAGGTTGGACGCGAGAGCTGGGAGGCGCCAC