Description :
From Genome Similarity Track
Location :
Scaffold_300:25963- 27284
Sequence
1321 bases(100 bases per row)
CGGATTGGGCTGGTGACGTCGAGACTCGACGCAGTACAAGCGGCTACGCGTTCATGATGAACGGCGGATGCATTAGTTGGAGAAGCAAGAAGCAGCGCAC
GGTGGCGCTGTCATCGACGGAGGCGGAGTACATGGCGTTGACGGAAGCTGCTCAAGAAGCGATCTGGCTCAAGACATTCTTGTGTGAACTCGGCGAAATG
AAGAACGAGGATTCTGTCATGATTTTCGAGGACAATCAAGGGTCGATTGCGCTGGCCAAGAACCCCGAGTTTCACAAGCGCACCAAGCACATCGACATTC
GCTACCCCTTCGTGCGTGAGAAGATTGAAGATGGCCAAGTGGTGTTGCAGTACTGCTCGACGAAGGACATGACGGCGGATCTGATGACCAAGCCGATCAC
CGCGGTGCAGTTCGAATATCTTCGCAACAAGCTGGGTATCAAGCCACCAAGCGCGGTCGAGTCGAGTGGAAGTGTTGTCAAGAAGGCGTCTCGTCCAGCT
TCGGCATACCAGTAAAACCGGTTTCCAAGGACCCCGCGATGTTTACGGTAAGTCAATTGCGCAAACGGATGTATGCGCAAACAGATGATTGGACGAGTCC
AGAGTGTTGGTGATTGGATGCACCACATGATTGGATGCAGACTAGGACGTAAGACAGAGTAAGCTCCAATAAATCAATCACTTTGCATTTTATCATCTAC
ATCTAGTGCACAAACGACCTTCCTTTTAAGTCGACTTCCGGCTACACGTTCATGCTGATGGGTGCGCCAGTGAGCTGGGGCAGCAAGAAGCAGTCAAGTG
TTTCGCTGTCTACGAGCGAAGCGGAGTACATCGCGCTCAGTCTGGCAATTCAAGAAGGCAAGTGGATTCATCGTCTGTTGTGCGAGATCTTAGCAGCTGC
CAATGAGACTGGACCCGACCTCAAGATCCAAGAAGACAACCAGTCGTGCATCAAGATGACGAAGGATCCTGTGAACCACGGCCGCGCCAAGCACATCGAC
ATCAAGTACCACCACATCCGCGATGAAGTCAAGCGTGGTGAGGTCAAGCTCGAGTATTGCGAGACTTCTGTGATGCTGGCTGATATCATGACGAAGGCGC
TCCCAAGGGCCTCGTCACATGGACCTAGCAGCTGCTCTCGGCATCCACGCATGTTCGCATTGAGGGGGCGTATTGAGGGTTGCTGGTCTTGGTACTGTGT
ACCAGCTGTACCCATTCACCGGTCAGCCTGAACCGGTCCAATACGATCCCGCTGTGATTATGGTACGTTGTTTATGCCACCCATGATTGGACGAGTAGAA
TGATTGGATGACCTAGGTAGT