Description :
From Genome Similarity Track
Location :
Scaffold_55:259626- 274158
Transcript NameFunction/comments
Phyin_T30-4PITG_17452Importin alpha-2 subunit
Phyin_T30-4PITG_17453Putative uncharacterized protein
Phyin_T30-4PITG_17454Putative uncharacterized protein
Phyin_T30-4PITG_17455Vacuolar protein sorting-associating protein%2C putative
Phyin_T30-4PITG_17456Putative uncharacterized protein
Phyin_T30-4PITG_17457Putative uncharacterized protein

Sequence
14532 bases(100 bases per row)
ATTAATAAAAAGCAAACAGGGTGATTTGTTTCGCGCGAGCACTATCTCCCTGGGGTGTTCAATAGCGTCCGTCCAATGGTTTAATCCTTCCACTACTGTC
TACCTCATCATTTCCTGGTTGACTGAATCAGTTCTGGCCAAACTGGAACATGGTGGGCTGGTCCGAAGTTGTGCCGAAATGGAACTGCTGAGCGTTAGCA
TCGGTGTTTGGCGCTAGGCTATCCTCCGCATCCTCTTCACCGTTGAAGTACTGTTCCACGATCTTCATAGACTTCAAGTAGATGTCTAACGATGATATAT
AAATCATAACATAGTAAACACAGCCGTTTCAACCATAAGAATATCACTAAATCAAGCGCACCTTCGTTGGCATGGTACTGCAGAGCCTGAATCTTGATAA
CACCGTCCGCCTCATCGATCATCGTAGCAACGTCGTTGATATCGCTGGTCTTCTGTGACTCGCCTGCCCGCAGAATGTTCTCGAGACCTTCGAGAGCTAC
AATCACAACTTTTGCATCCTTCTCCTCCAGCAGGTCGCACAGAGGCTTAATGCATCCTGAGCACAGGAGCAAAATATCGACGTTACTACTGTACAACAGA
TACCATCAAAGCCGTTGCACTTACCAAGGCTGACGAGGTGCATGATCTGTTCCGCCGAGCCACCGGATGTGGCGTTCGATACAGCCCACGCGGCTTCCTT
GCGGATGTCGAACTCAGCAGTCGACAAGAAGCTGATGAGGGATGGGAAAATTTCGGCCTCAATGATGAACTGGATCTGTTCCTGGTTGCCGGCCGTAATG
TTGGACAGTGTCCAGCAAGCTTCCTTTCGGATGCCCTTCTTGGGGCTCTCCAGGAGTGCGCGCAGACACGGCAGCGCGTTCAGGTTAATAATGACCTGCG
TCTGCAGATCGTCGCCCGTCACAATGTTACCGACAGTACGCAACGCCGGCGTCTGAACGGAAGGAGAGTGATGCATCAGCAGCTCCACAATTCGTCTGCA
CACACCAGCCTCAATCACAGCTTGAATCTTTTCGTTCGAGCCATCTGACAGGTACGACAGAGCCCAGCATGCGTCCGTCAGTACTTCCTCATCGTGGGTG
TAGATAAGCTGGCCTAGAGTCGAAAGCGCAGGCGACACGAGGTCAAATTGCGGCTGTGGCTTGCCACGGCAAAAGTTGGATAGCGTCCATGTCGCGTTAC
GAAGCATTGTAGATTTGGAGTTCTCCGTTAGTTGCTGCATAAGCGGACGCAGAGCACCGCAACGCAGAACCATGTCGCGACACTCGATGGAGTCACCGGC
AATGTTACCAAGGGCCCACACAGCCTGCTCGCGCACATCGTCATTCGTGGACAGCAGCAACTGGCAGAAAATAGGCACAGCACCATGGTTGATTACCACC
TCAGTATCTGCAGAGGTACCCGACGCAATGTTCGTCAGAGCCCAGGCAGCCTCGAACTGAAGCGTCGGGAAGTCTTCGCGCTGAAGAAATTGCACGAATA
TGGGGACAACACCAGTCTGGATCACTTCCTTTATAGGCGGGTTGCGCTCTACAGACCACAGTTAACAGTTATTCAGAAAGTGTCATATCATCCAACAAGA
TTGCCAGCGTGTAGATAATTTCTCAAGCTCACCAATAGACAAGAGCTTGCGAAACTTGGTTACCGCCTCGAGCTGCACCGCCGCATCTCCGGACTGCACG
CAAGCAACCATTTCCGGAAGCTCCGACAGCTGCAACAGGTCACCACGCACAAGGGTCAGTTTGCGTGCTGTCTTTGGGATACTTGTTTATCCTATCCTGC
TTACGCGTTGCTGCAGCGTCATCTCGCCTGTGGCATCTCCTACAGCAGCCGTCGCTGCAACTCCGTCGTCCGCCGGCGTCTACATCAACAATAGCAGAAA
GTGAGCTACAAGTACCCACGTTCTGTCCCATTCCACCTCAACTGTAGGATACGTTGCGACCCTAGATTTGCATTTCAATAGAGACGGCTTCTGCCTATCT
AGTACGAGTTTGCTCCTTATTGTCTATTGCTGGTGTGGGGTTCCGTACCATGCGGCGACGCTGGTTCATGCGGTCCTCCTTGATGGTCTTGCGAATCTGC
ACCGTCGTCTCCATGCGGCTTCGACGCGACTCATCGGCGTCGATTCCCTTTTTAAAAAGGTTCTTACGCTCCGGTGCTTTTCCTGCGGGGAACGACATGC
TTGCTACTGTTGCTGGAGCTGCTTTCCCGGGACGCTGGCCTGTGCGGCTTCTTTCCTTGTTTCCCCTTCTCGAAGGCTTCGCGGTACTGGTCGCCAGTAA
AAACATCGAGTGTGGACCACACTCTGCGAAGAAAAATGATCCCTTACAAAATTCAAGAGGTTTTACGGTTTCCGATAAAAAACCTCGCATGAATGGCAGA
TTCAGAATTCAAGGTAAATTCAAAATCAATTCGAGATTCTGGACTCCAATCTGGAGTGAACGTCCTTCAAGTTGCTGCCAACCGGCGCAGGGTGGACGAT
ACACCGATGACGTCGCTTAAGAAGCTGCCGTTCTCCACTACCACGACCGATAATGTGCCTGCATCTTTATTGTCTAACAACGTGACTATCCATGTGTTTG
ACGAGTGCCGCAAAAGCAGCAAAGAGTTTACGTGTCAGCGCGGTCTGCTGCTGGCGAAGATGAAATACTTTCAGGCGTACCTAAACGAGGCTAATGAGCA
CGATGAGATCGACATCTCCGTGCATTGTGACGTAAAGATATTCGAGCTACTCGTGGAGTACATGCACCAGTGCGACCACGAATGGCGACCGCGCATCACT
CTCGAGAACATTGCGTCAATCCTCGTGTCCTCCGAGTTTCTGCAGATGGAGGAGCTCGTGGAGGAGTGTGTGGCCTTTATCTCGGGGTGCGTGCAAGAAT
TTATGCTACTGCGCGTGGACTTTGGATGCCTGTCTGATACCACCATCTCCAAGATTGCTAATAACTGCGCACCCGAGCAGCTGCACGTGCTCCACGACCC
CAAAGACAAAATCCTGTCCAAGCTGCGACGGAAGAAGGTCGAGGCGCTGGTGAAACACGTGCAGGAGGGCGACCAACGACTCGAGCTGTGCTTAAATTGC
GAATTGCTCTTTATTAAGGATGGTAGGGGCAGTGAAGGCTGTCATAAAGGTAAACGTCGGATCGGAATACATGGCGAGTTAGTGGGGAGGCATCAAGCCA
AAATGGGATGGCAAATCGGGGCATTCTGCGAGAACTCGGTACCGACAAGAACCATGTTCTGGAGCGCAGCGTACTGGGTACATTTGGGGGTTCCCTGGAA
GGGTTTCCGCTGCAGCAGGTGCGAGCAAAGGTGTTGCTTACTTGAACTGCAAGAATGCGCCAATCACCCCGGTTCCATCGTCGACCATGGTCCTGCGGTC
CAAATATTCGTGCTGCTACGCGCGGATTTTCAGCGTCGACGATATTTCGATGTGCGGGTGTAATACCACAGTCCATGTGCCACTAGAAGATGATAAACAC
TCCCACGTGGACAAATTCCGCAGTATTATGACACTTCCTAATATGTGGGAGTACGTTCACGCGTGCGAGAAGGTGGCGAGAGGAAAAGGTTCTCTATCAA
GTGCGGCTGCAGGTGGTGGCGGTATAAGTGACGTGGCCTTGCTCTTTCCTCCTCCGCAACTGAAAACTGTCGCGAATACGGTCGAGCGCGAACGGTCCTC
CAGGAACTTAAACTCTGAAGGGGAAGGCGGCTCCTCGGGCTATCGGAAGCAGTACAAGGTGCTGCAGTTGCAAGAGAAGGATCGCATTCGTTGCCAAGAC
ATCGCGAGGCAGCTTCTACTGCAACGAAAAAGCTGATTACGCTACTTCTGTGTACCGTACATAATCAATATTATTGGAAGCGGTGATGTGGAAGCGTCCC
TTGCGAGATGTGGTGGTTCGTTGCCATGTAGGCAACCTGCGAGTGTCTGGAGTGATGACGCGCGATGTCGTGGAGGACGTGTCGCGGCGGTGGGGGCTAC
CGCTCACCTCTGACGGTACGAAGCTCTGGGGTGAGTACATGGCGGGCACTGCCATGCTCAGCTCCCTTTTAAAGGGGGAGGAGCGCGTCAAGATGATGAT
CAAGACACCCAACATTCAGGAGCTCTACGTCGAGGCGATGGCCGTCGGAGAGGTGCGAATTTGTTGCAGTATTGCAATGAAGGTGAATAATATTTTATCT
GAAATAGGTTCGAGGCAAAGTTGTTTACGTGGATCAATCACGTGCTGGGGTTCCGGAACATGGAGGACACATGCACGTTTCCAAGATTCTGTATGGCGCT
GCGAAATCATACAACACGTCCATTGAAGCATCTGGGGTGCCTGAACTCGACTGGCAGAGGTTTTTCGACGTATCAGAGCAGGTTCCGACTATCGTGCGCA
TGGATAGTGAGTCCGACGAAGATCATACCCGCACCTGTGGTCTCATTGTTCAGATAATGCCTCCAACGGTGGAACATGGGCGACACTTTGAATTAAACGA
CCTGGCATTCGACAAACTCCCGTTTTGTGCCGCGGAGTTGAAGAAGAACACCGACCTGTTGGAGTATCTGAATGAACTGATTTTGGGGGCTAACTTAACG
GATAAAGACTGCAAGCGTGTGCCACTGGATTACCATTGCCGCTGCTCCAAGGATAACTACGCACAGCGTCTTAAGGACATGGGACCCACCGATCTCAAGC
AAATTGCAGCCAACGTTGGCAGCGCTGGCGTGGATCTGACTTGTCATTTTTGTAATGATGTACATCACTTTTCTGCCGACGAGCTGGATGGTTTGATTGA
ATCGATGTCCGAAATGAAGAAATAGGCAGATATATTGACACGGCTTTTGAAAGATGAATTTGACGAAGTCATCTGTCTCGTTGTGTTGATCTAGCCTTCT
TGTCCAAACTCCTGCGTCCATTTCACAAAGCGGTTTAGCTCATCAGGGGCAACAGTTGCTGTTGAATGTGCCAGTACACGTGTGAAGTCACTCTGTAGTG
GAAATCAAATTATCGAGTCAGCAGCCAAGACCAAACCTGAAAGTGAATAAAGAGAAACTGTCACCATCGAGATCATTGGCGGTCGCAGCTTTTCATCAGA
GTAGCCACGCTCTGGTAGGTCGTATAGTCGCATGCGCAGTGCTCCGCAAAGTTGACAAGGGGCTTTGCAGTCCGGACACTTTGAGCGGCACGAAGAGAGC
TTCATGTGGCAATACGCACATGGTGGGTCGTCTTCGCAAGGTGTCAAGAATTGACCATTCCGGACAGGGCGTGCCTTGTCGTTACACTGAAAGAAGAAAA
TAAAGTAGTTATGTAAAATTAAATGCCACATGAGTACCAATATTTCAGCAACTTCACCGCAGTAAAAAACTGAGCTTGTTGACATTTTCGTAGGGGCTCC
ATTAGCGCATCTCGGACAAGCACCGAGATGTCTGAACCAGAGCACCTAAGCACACACCAGAAATTTACGTCAGCATCAGAAAATACCTCGGCCATTACGG
TGAAGGAACGTGCTAACGTACCCTTCTGTTTTCTCTGCGATCGCCGCGAAGTTGTTATCACTCAGCTCGTTGGGCGTATCTCCCAGGTGAATTCCCAGCA
TCACCTTCCGGGCATTGATATCAGGAAGAGGAATGTAAATGCGTTTTTCGAATCTGCACGGGCCAGTACATATAGCCAGTTAGCTAACGGGGCCGTTCCT
TCCTTATCTAAGTAGCTGTAGTACGCATTACTCACCGCCGTCGCATAGCTGGATCGAGTTCCCATGGTACGTTCGTAGCTCCGAGCACCAAAACGCCGTC
ATGGTTGTTGCCCATACCTTGCATCTGAACAAGAAACTCGTTTTTGATACGGCGCGTTGAATCGCTTTCACCTTCAGATCTACTTGAGCACAGCGAGTCG
ATTTCATCTATGAATACTATCGCAGGCTTTTTCTCACGCGCCATTTCGAAGAGGTTCTTAACCAATCTACAGTATATACAACAAGGGGGAGGGGGGGGGC
ACGATAAAGTCGTCAATAAGAATCTGTGTCAGATTCTACCACAGTGTAGTATTTCAGTTTCGTACTTTTCGCTTTCACCTTGCCACTTCGACACCAAGCT
TGAAGATGAGACGGAGAAAAACGTGGCGTCTGCTTCAGTTGCGACGGCCTGGGCAAGATACGACTTACCCGTACCTGGCGGCTACAAAATAAAAAAGCAG
GTGGGTCCACCCAACAGCAGTGCCACAAATACGGACTCAGAACCTACCCCATAGAGAAGAATCCCCTTCCAGGGACGCCGCTTGCCCGTGAAGAGCTGCG
GAAAACGCGCCGGCAAGATGACTGCTTCTTTCAGTGCCTCTTTTGCAGCGTCTAGCCCAGCAACATCGTCCCACTTGACATTTGGCTTCTCCGACACCAC
CGCCGCTGTGTGACAACAACCGAGCAGCCCATTAGCTCGCTACATATCGAATAGATTTACTCGTCTGGACAACTAACAAGCAAGGGAGCCGCGCAGTTTG
GCTGTTTCCACGTCCGTCTCATCGTCGTCTTCCTTGTCGCCTCTACACGCAACAAGAAACAAACAAACAAAAACATTAGCTTTCTTAAGCTTTTATAAAT
ATCCCCCATGACAACTCACTTGTCTATGTCTACAGCTGCTGCCACTGGCTTGGGCGCGTTTTCTTTTTCCAGCATGCCTCGCAGCTGCTCCGCGCGCGTC
ATATACCCTTCCACGCGCTTCATGATAACCTCCTTAGAAGTTGGGTTCTTCTCGTCTGTACGTCGAAAGAGGCGTAAGAGGCACGTCAGTCCCTAGCGCT
TGGTTGGCTCGGAAGTGCCAACTTCTAACATACATTTGACGCCGACCATGAAGTGCTCTAGCGCCTTCTTGTACAGGCGAAATGCCTCGTGGTAGTTCTT
GCCGTTGTCCTCATTGATGGCCTGCGTCACGATCTCAATGGCCTGTGGGATGAACCTGTTCTCCATTGAGGCGCTACAATTGTAAAATACCAAGAGTGGT
AAGGAAAATCCATTGTAGCTTTTCAACATTCATCGTATTGGTCAAAATAATTAGATTACATCCAATCCCAACGATACTGACGCTGAAGCCATTTCGCATA
ATGGGGGTGAGCCAGTCGAAAGGCGGGGACAGCGGCGGTGTACGCTGGAAGCTTCGGCCGTTGGTGCCACGCTCGTGGGCGGAACTGGGAAAACTGCATG
TGCGCTTTCAGCAGGAGACGTATCGCCGCCGAGCTGATCCCGCGTTTCAGTACTTCATGCCCTTTCACGTGTTTCGGGCCATCGTGACGCCACTTTGCCC
CGAGAAGGGCAAAATGCAGCTACTGGCGATGTTCGAAGATCTGGACGTGAAAAACACAAGAAAACTAGTCGTCATGGATTTCTTTAGTGGGCTGGCACTC
CTTGTTGATGCCAAGAAGCTCCAGAAACTTGAATGTGAGACCACGTAGCAGGTGCTGCAGAGTCGTAGGGGCAGAACTAATATCTGGGACTTTAGTTGTA
TTATCGCTGCTAGATAATGGTGGTTTTAACACTCTCAATAAGTGCGAGTTGACGATGATTGTGTCGTCTGCTGCCAGGGGGCTGAAAATGTTCGCACCTG
GAGCCGACGTGCTGCAGGAGGCCACGATGAGGCCTTTAATTCGGCGTACAGACGCACAATGCGCACTGAAGCAATGCAAATGACTGCTGAAATCGTGTTG
TGCATCGTACTACAGGTTTATTTGGCTGGAGTGATGAGGAATTGCGGCAAACTGTCATCAACAAAGCTCTCGCGGACCCTGAAATTATCTTCTTCTTGAG
CGATCTAGAGGCGGTGAGGATTGGAATCTGCCATGTACGACATACAATGTGTTACAACTTTATAAAATTATGTCGGATCATTGCAGGGTGTAGCAACATC
TTCCGGAGAACTATTAATTCAGCAAGGCAAGCTCATGAATCGTATTGCCTACCTCGACTACCAAGCTGCACGAACTGCGACGCCAGGTATGATACTGTCG
CTTTTCCATCGCATTCCGCTGTTCAGTTGTGCTGATTTTGTCGTATGGCATTTCCCAGAGGGGGGAGCAAGAACGGCGGTCGTATTTGATCCAGGCAGCG
AGCCCAGCAAAAACACTGAGGACAAGTGGCCACTAACGCCCCCACTCGCTTCCACTGCAGAAAGTTTCACCCGAAGACTTCAGAGCGCAGTGTGCTCACC
TCCTTCAATAGGATCAGACCAGTCAATGCGCGTGCTGCCCGCCGTCGAGATTAAAAAGTATGTCAATGCTTGTACCTTGCAGCGGCTGGTCACGGTTGCA
TCGGACGGTTGTCTTTCGCTCTCGCTAATTGAGGTAAGTAAATGCTGTCTGTAAATTATACGAATTCATCGCTTTACTGGCTTGTAGGCCACAGTGCTTG
TAGGAGAAATGACCGTGGACCAATTTGGGCTTGTGCGGTGTGGCGACATCCTCCGCATCCTGACAGCATGGGTGCAAAATCGACAACAAGAAAAACCAGA
GGCACTGTGGGAGGTTATGAGCAATTTTGTAACCGAGAGTGTGACAAGATTGGAGGAGCGCATGCGTGCTACGTTTGCTGCTTTCGGTAAAAGAACGATG
ATTACGCTGGTGCAAACGGCACGTCGACGCACAGCTGTAGCCATGGATCGTCTTCTTGAGAGTTTACAACTTGTTAAACTGAAGCCTGATGCTGATGATG
GGGAACTCCAGTGGAGCATGAACATTTGTGTTGGTGCGAACGTGACGCCAATGAAATCACCGATAAGTTCGCCTGTTTTAAAAAGCATCGGGCCATCCGT
GGGAAATAACATCAGATTCCGGCTGGGGATTCATCCTCCGAATAGCGATCTGGGAGTCAAAAGGAACCGAGCCGAGCTTGGGAAAGAAAGACTGCTCAAG
TACGACAGTGATGACAGCCAACCAGAGGACCTGGACGTTGGTACTATGCGCGTGGTCGTAAACTTCTTTTTGAATCCGGAGACCACGGGTAAGCATCGAT
AGTGCTTTCTAAATTGTGTCCAGCTCATTCTGCGTTGCTGAACGCAGATAAGGAAGGAATTGACTTGGCGTCGTCGGTGGAGAAGGCAATACAGCAAGAG
CGAGTGTGGGCCTCAATGGCATCACTTTGGACAGATTGCTCAGGTTTCACAACTGGCGTATCCACTGGCCAGCTTAAAACACTAATTGAAGTGCGTGCTC
TATCATGTCCTCAGTTTCTGTGCATCCAGCGATACGATGTGAGGGAGGGGTTCAACCTGTTGTTGGCAAGTATCTCCGCGTGTGTATCGACTTCCGCGGT
GATTTTTTCTCTGCTGTAGAGGTGGACTATCTTGTCTTGTTGAAGGAGCAAAAACGCCTCTCGCATTCTTCCTGTTGCTCCATATAATGCTGATACATAT
TTGCTTGGGTGTGTAGGAGTGCACAGGCGCATCATTTGCAGCTGGAATTCGCAGTTTTTTCTTGCTAGGCGAGTTGGATCGGTCTCTTTCAGATATCTGG
CATCTATCACGGGGGATGGCAACACTACAGCGAAGCCTGGGGCAGAGGCAAAATCGAGAACGTGCGATAAGGATGATTTTTGATGCTTTCGTCGCAAACC
ACGATGGCGGATGGGGTCTTCAGGAGTTTAACACCTTCCAACAGGCGCTTGGGAAAGAAGCCCTGCACGAAGCGACACTGACCGAGTTGTTCGGAGAAGC
CTCTACAATACCTTTTGAAAAGTTCATGGCGAAGTACGAAAATTATCCAGCGACAAGATTATTTGAGATGATCCGTCGACTTGGAATTGGTAGGGATCAC
TGCATGTACTCCTCTTGATGGGATTGCTGCTGTTTCGAGCGTTATTATGAAAGCTGACAACGTTGCTCGTACAGGATCACTTGGCGACCTGGTGAAGGGT
TCCATCTCAATAACGTCGACGTCAAGTGAACTGTGTGTAAAAGCTCTGAGTGTTTTACTGAGCCCTCTTCGCTGGGCGGATGCTGTGTGGAAAAAACTGT
TTGTTTTTACGAGGAACACGAAGGATTTAAGCTTCGAATTCCGTTCCATCAAGCTAGGCGAGCTCGTACAGAAGTTTTTCAACCATGACACACCGAAATT
TGTCACAGATCCGCTGTTTGTGGCCTCGTGGATAGAACGATTTGAGGAATTTATCCATCCTCCGCACGCCGAGCACTCCAAGGATCGACCATGTCGTAGC
ATTTTTTGCTCGTTAGAACAAGAAGTGAGCAAGACGGAGCAGCAGTTGCAGTTCGATGACCAAAGCAAAAGGCTACCACGGGGGACATCTGCTTGGCGCG
CTAAAGCTTTGATTCAGTTTCTGGAAATGGCAAAACTTGTTCAAGCGCATGTTCGAGGACCAGAGCTTCTAGATATACGCAGTAAGAGTATTCGCATTGT
GTTGGAGCTGGATAACTGCTGGATTGCGCCTCCAACACGTCCGTTTGTTTAATTTTGGAGCTCAAACCATTTTGGTCATAAGCGCTCGATAATTAAATAG
TTGCAGTGGTGCACTTCTCGAGCGATGAATCGTTTACAAAAAATGACGGCGGCTATTAAAGCAGACACGGGTTTAATACTCTCAAGCGAAGAGTCCAATG
CAGCCTATACTCAAGCGCTCCAGGATCGGCATTGTGGTTTGTATCAAGATGCCGTAAATGCTTTGGAAGGCATCATTGAGGTAAGTAATACAGTAAAGCA
ACTTCATCCATGAAATGTTACCCTAGCGAACTGTTGACAGCACGAACCTGACTCCGAGAAACTATGGACTGAGCTTGCGATCACACAGTTCCAGCTATGG
GAAGCCCACGTCAGGGCATTGCACATGCCTTCCATTCTCGAGGTTTCATCAACTACACAATCCAAACGACCCGGTGCTGATGCGAAACCACTACACACTG
TGCTCCTACAGGAGGCCTACAGCACTTTCCTTATTGCGATGGAATATCCGAACAGCAAATCGAGCCCAGAACTGTTGCTTCCACTTGTGAGGCTTTACAT
CGAATTTGGTTCATACCGGGGTGCACTTGCTGTGTGCACTCTTCTCGTTGAAGGCTATCCGACGTCACCTCGCCTTAATGAGGCCATTTTCTTGTCGGCG
CTAACCGCATCAGCCATGGATCGACATCGAGAAAGCGCACAATACTTTCAGTATCTAGCCGAAGAACAGTCATTGCCTCCGTATCGACTTGCAGCGTATC
AATTCAGTCTGCTAGCAGCATTGGAGCTATCTGATGTACCAGGCATGCGTGCACTCGAGCGTGAGACGTATACTCAGGCGTACAAAGCGCTTGTTGTCCT
TCCGCCAGTATTGCCATCAGAGAAGGCCGCGCACATATTATTCATGACGTCGCGAAAGAACGAGGATCAACGCACACTCATATGGTGTCGTGATGTTCAG
ACGTGGTTGGATCTAGCGCAGCGGCTCGCAGGACCAGCTAATGCACCGCTTCTGGTTCTATCAACTCTTCGTCAAGCTCGACGCAGGATGAAGCCAGCGT
CAAAGGGTTTCCCTGCAGCCGAACGTCTTCTGGAAGGTGCGAATCTGTTGCGTACTGGAAATAATCCAGGGGCAGAGAAGGTTATTGCTGAAGCGCTGTT
GAGGCTACCTCGGGATGAATACTACATCGCCCGTCATGAGCGATTCCTGCTCGAGATGTGTAGTGTTTCATGGCGAGCACATTTCGCCTTGGAGCACAAG
AGTGCATCACGTTTGCAATCTTTTGTTTGGCGGTGTTGGAGGTTGGTGAAGTGGCGTCTCGGTGTCGCGTATGTGTTGGAGCAGCACCGCAATGTGATGG
TAGTACGAATTCAATGCGCGTGGAGAGGGTTAAGAGCCCGACAAGAATTTGAATTATTGCGTGAAAAGCAACGAGAAAAGGAGGAGCTTGAAAATGTTGA
AATGGGTGATCAAGACGACAGACTAATCGAGCTTCACCTGAACTCCACCGCAAGGAAAATTCAATCTCTGCTTCAGATTGCGAGGAGCAAGCAAACAGTG
AGAGCTCTCCGTGCGCGAAAAACTGAACGTGAGGCTCGCTTGGCGGGGTTTGCTGAACGTCGAATCGAGCTTGGTCAACTTGGAGTCTTTCGTAGATGGC
GCGGTTTCGTTTCCTTTCAGAAGCAGGCGCGCTTCGATGCTGCTGTGCTCATCAATCGTCAATTTCGCGCCTGGCACAGCCGCAAGCTCTGCAATCAGAT
GCTGCTTCAACGTCGACAACAAAATAGCATCCTGCAGCAGTGTCGAGTCCGACGTTCAGCGTCGCTGATATTGCGCGTGTTTCAAGCCTGGCACACGGAA
CTTATTGAGGTTCGATGTCGACGTGATTGGGCTTCACGGGTCATTCAGCGAAAATGTTGTTCAAAATTAGTCGTTCGTCAATACCATGTCGAGCTGCGAC
ATCACCGGGCAGCGACCGCTACGATGAATCACTTGCTTTCTGATCGCAGACGAAAAATTCTGTTAAGCTTTTGGCGGGCACTCGCAAACCACGCGCTCGT
CCGTCGTCTGCGCAAACGAGGTGCAGCTGTGACCATCCAAAAGCACATGAGAGGTGTACTCGCTCGAAAGCAAGCGAAACGGCTTCGAGCCCGTCGTCGA
CGAGCTCTCAAGGTACTAGTGAAGCTTTCATGCTCACGCCAAATTCAGCTTCTGCAGACAGGATTCAACTTTCTTTGTCAGCACGTTCAGGCATACCACA
GAAGAAGATATGGCGCGGTATTATGCATCCAGGGATTAGCTCGGGGATTTGGCACTCGTCAAAGGCTGCATCGACGCCGTATTGCAGAAAGACTCGTCAA
CGGGGCCGTGACTATTGGCAGTAAGCTTAAGGGTCAATCCAGGGACATTAAACTGTGGGCATGTCTGCTAGAGCTCTCACGGTGCATATCACTCCGCCAT
GCTGCTGTAATTCAGGTGCAACGGTGGTGGAGAAGTCGACGAACGCGCTCTCGTACACTTCGAGTACTTAAAAAGCGTGCAGTGCAAATACAACTACTTG
GCAGATTGCAGAAGAGTTTCTACACCCTTGCACGAAGCATTTTCCAACAACTTCGTGCAGAATCGAATGCCAGAAAGGCCCACCAACGCGCAGCAGCAAA
CATAATACAACGCCGACTCCGATGCTGGTTGATGCGTCGACGGTACCTCAGCACGCTTGACAGACAGTCGATAGCTGCTCAACGTGGCAAAAAAGCTTCT
AAGAAAATAGTATTCCAAAGAGTGCGTCGATTGTTTTATGGCTGGAAAGAAGCGACGCGAGCGACACAAAGAGAGCAGTACGAAGCAGCTTGTCTAGTAC
AGCGAATATTCCGTCACCAACGTGCACAGCACCAAGCACGCTGTAACATGGTAAAAAAGGCAGCTCAAGAGCGATTGGTGGCTACAGCCTCACAAAAGCC
ATTGGAGCGCTTCTTCCGTCAGTGGGAGGCCGCGGCCCTACTTGATAAGAGTGTGCTGCATGTACGCAGTTCACCGTTTATAAAGTCAACGCCCGTGAGC
GAGCAGTGGAAGCCTGGTACTGCGTCTGGAAACAAGTTTGACAAGCCCCTCACGCTCGAGGAGGTAAGCTGCCGCCGGCAACGCGTCATACTAGTAAAAT
GCACTACTAATCTCTCGACGTTCTTGAGCCCAGCGTGCAGAGATACCATCAATGCTTTTCTACATATTTCTCAATCGTGTTCGCCAAACTGGGATATGCC
AGCTTTCGTATAGGTAAGTTCATACAACATTGTGATCTTCCACACGCCGCGAATGTCAAGTGAATAACCAGTTTCCTTGTTTCCCAATTATTCCACCCAG
CGGGGGCACAGTATTCAAGAGTCCGCAAATCCGACAACTCATTTCTCTATCCACTAGCGTTATTGCCGACGGTGGTGGCGGCCTCCATACCAATTCAACC
TCCAGTAAACCACTACTCAATCTCAACGAGCAGGTCGTGGACGCTTTGGACGCGTGCTCCAGCTCCCTTTCCAACTCGTGCCCTGTGCGGTCCCTCATCC
TGTGCAACGCGCCGCTCCGATTTTTCCATGCGTCTCTTTTAGCAGCCATAGTGCAACGCAGCCGCCGCAGTTTCAACCTCGCGCTGGTGTCCGTCGTGCT
TGTCAACGTCCCGCTCGCTCCTGTGTCCGTCGTGTCCCTCGCCTGTGCATTAGCTCAGAATCCGAGCTGTTTGCAGCAACTTGTTCTAGAACGTTGCCAA
GTGGGCAGTGCTGGTGCCGCCGCGCTATTCGAGTCCTTGAGTTACAATCGAGCGCTGTGGAAGCTCGACCTCAGCGGGAATCACATCGCGGATGCTGCCT
GTCCTGCTCTTTCTCGAGCGCTGTTGGCCAGCAGCCAATTGCGTGTTTTGGCGCTGAGCCGCAACTTCCTGTCGGACCGCGGCGTGTTCTGCTATCTGGC
CCCGGCACTGGCCTCGAGTCAATTGGAGACGCTAGTGCTGTTACAGAACCCGCGCGTGTCGTCGATGGGCATCGGAGCACTTCGCCAAGCAGCGTCAACA
CGCGTGGTTTCAGATTGAGCTCTGTGATTGGT