Description :
From Genome Similarity Track
Location :
Scaffold_257:25959- 28230
Sequence
2271 bases(100 bases per row)
CGGAATGCGGGGGTTTGTGAGGCCGTTTACGTAGAACGGAGTATAGCTTGTCGAGGCATGGACGGAATTGTTCATGCCAAACTTAACAATGGGGATGATT
GAACTCCAACGCCGAGACGTCTCAGCGCACACGCTGCGTAAGAGTCACCGAGGAAGCGATTGACACGCTCAGTCTGACCATCGGTCTGGGAATGATCCTC
TCTATACACGTCTAATCTGGTGCCGAGCACCTTGAATGTGGCCTTCCAGAACTTAACCGTAAAACGAGGATCGCGGTCAGAGAAGATTGCCTGTAGCAGT
CCGTGTTGTCAAAACACGCGATCAATAAACAGCAAAGCTGTACCTTCACCATCAATCGAATCCGGCACAGCCGCTAAGTAAGCCATTTTGCTCAAACGGT
CGATAAAGACCACAATACATGTGTTTCCCTCTGAATCCTTAGGTAGGACAAACAAAAAGTCCATGCTGATGGACTACCAACACCCAGAGGGTACAGGCAA
ACTAGCCAGCGGCGCAGTGACATGTACCGAGGGTTTGACACGTTGGCACGTCTCACATATGCGCACATAAAAGCTTACCCATTTATAGAGTTTGGGCCAC
CAATAAGTATGGCTTACTAAGCCGCAGGTCTTTTCACGCCTAAGATGACAGCTAATAGCTGTGTCGTGGAACTCATAGAGGATACGGTACTTCAGTTCCT
CATATGAGGAACAATGATCCGCGGGGTATCTGCGGTATCCGTGCGATAGCACAACAAGTCGTTATCGATAGAATATCGATGTAGCCTTGCATGCGAACGT
GCCGACAATTTAGGGTCCGAGTCCTTAAGCTCATCGCTTCCAAGAGCACGTAGCAAAGCTACACATTTTCCTCCTTGGCATAAGATGCACGGATTAAGTC
AATTATTGACGACGAAAAAATGGTAGCATGATTAAGCTCATAGCCGGGCCGTCGTGACAGTGCATCAGCCAGCGTATTTTGCTTTCCCGGCTTATACTTC
ACCTTCAAGGTATATTCTGCAAATAATAAAAGCCAACGGGCCATACTCTGCGAGAGGTGAGGCGATTGGGTCGCCGTGCGTAAAGACGGATGATTGGTTT
ACCCTATAAAAGGCTTGGAGACAAGTAGATGAACTCTGAATTTGACTAGATCATACTTCATAGCAAGTAGCTCCTTGTCGTGAACTGGATAGTTCTTTTC
AGCAGCTTTAAGCTGACGGGATTCAAAAGCGATGACACGCTCGCGTCCCTGAACATCTGTTTGTAACAGAGCACAGCCAATGGCAAAATCCGAAGCGTCA
TAGACGACACTGAAAGGTCGATCAAAATTTGGCAAAGCCAAAATCGAGGCATGTAGGAGACTTTCCTTTACGGCCATAAAAGCCTCTTCTTTGGCGCTAG
TCCATCATCACTCCACTTACCTTTTAAGGAGATTGTATAATGGCCGAGCCATATCAGCGTAATTCTCGCTATACTTGTGCAAAAAATTGGCAAGGCCAAG
CCACTTGCGTAGATCTTGCTGGTTCTTTGGGACTGGCCAATCCACTATAGCCTCCACCTTTGCAGGATCTGCCCGAAGGCCTCGCTCCCCAATGAAGCAT
CCCAAAAATTGAATCTCATCAGCACCAGAGATACATTTTGAAGCATTAGCATAGAGCTTATTAGTGCGGATGCACTCGAGCACAGCGCGCAATGGTCGAT
GTGGTTATCCACGTCCGACCGACCCTGTTCCGCCCGACTATGGACAAATATATCATCAAAATATGTGTGTGCATACGCATGGTGAGGGTGGAACAATTGC
GTCTCCAGACGATTAAACGTAGCCGGGGAATTGGAAAGCCCCGGGGGCATAACCAGCTACTCCCAAAGCATACCGCTTGGAGTACTAACCGCTGCAAGCG
GAATATCACTTGATCGCACGAGCAGTTGATAATAACCATCGACAAGTTCGAGTGCACTGTCCATTTTACATCCTTCCATGTTGTGCTGAAAAATTTCTTT
TCTAGGAATGGGTTTTTGTGCCGGTAGAGTGGCCGCATTTAGCTAATTATAAGCACGTACAATACACCACTTACCATTAGGCTTTTTGACACAAAATGTC
GGTGTGGAATGAGTAGATTTGCACTCACGCAACATTCCCGCCACGCGCTTAGGACTGAAAAACTCGTCAATGACGTCACATTGTTCCTTTGGTCAAGGCC
ACTGCCGTGTAACGCAGTAACCGGTTCCTGGGGTCAAGTCAATTTCATGACGTACGCCCTTATCGGGAGGT