Description :
From Genome Similarity Track
Location :
contig_126:25958- 27371
Transcript NameFunction/comments
g13537.t1hypothetical protein

Sequence
1413 bases(100 bases per row)
TGTGACAGGCCTCTGTCATACGGGTGCCACCGCGTGTGCGCGGTGGCCAATCAGAGTCGAGCGTACAACCGTTGGTTGGGACGGTCTCGAGTCTCGACAC
TGCATGTCCACATCAATCAATCAGAGTTCATTTTACCTACTTCCTCGCAACTACAGTGTACGTCGGTAACGGGTTCTGTTAGCCCGTTACACCTGGTAGC
ACTTCGTCGTCCGTTCAACGCCCAAGATCAAGATGAACGACATCTCGAGTATGTCGTTGGAGCACGAGAACTTCCCGCACCTGACGCTGATGGAGTGGGA
AGCACTCCACCGCCTGGCAGCGGTGTCAGGCGACACGGTCGTCAAGACGCTCCTGACGACTGGAACGGAACACGAACAACGCTTGTGTGCTCAAGAGTTC
TTAACGCGTGAGCTCGCTGATCTACGTCGGCGTGCGACGACTCCCACGCCGTCCAAGAACAAGACCGACATCGTCAAGCTCGATGTCTCCACATACAGCG
GCGAAGGCAAGACCCGCCTTCACCTGAACCGCTGGTTCTGCGAGGTGGACATAGCGATCGAAGCTCGGCAATTGTCTACCGAGCTCGCGCGCACGCGCTT
CCTGCTTTCCAAGTTGTCCGGGAAGGCGAAGGAGTGGGCGCTCGGCCGACTCGTGGCCGACGCCTCCTGCTTCCCGACGATGGCAGCTATGCAGGCTGAC
CTGCGACTCGCGTTCGAGCCGCCCCAAGATGAAAGCGTTCAACGGTCGGCATTCCTTTCGCTAAAGCAGGGACGTCTGACCATGCTCGAGTACATTCAAC
GCGCGCGCCATCTCGCCTCGTGTATCACGACGCAGCCAGTCGACATGGCCACACAAGTCCACGTCTTTGTCTCCGGTATGAATGCTGGCTACCAGCGCTT
CTACTTGACCCGCAAGACGCCATCGACGCTGGAGGAAGCCTTCACTGTCGCTTTGCGTGAAGACTATAGTGTGTCGGCATCGCAAGCTTTCGATGTCTCA
CGGCCTCTTGTCCCTGACCCAGAGCCCGAACCCATGGAGGTGGATGCTATCCAGTCCTATCGCGGACGTCGGGAGCCGACGTCGCCTTCACGCCAATCCT
CCACTCGGGGTCGCGTCCTATGAAGTGTTTTCGATGTGGCAAACCTGGCCATCGCGCGGCGGTGTGTCGTGCTCCGTCGCCCATGGCGGCGAACGCTACG
ACTGCGAACGACGTCGCCGCTCCAAAAAACGGCGACGACCAGTAGGTGCGGGGCGCCCTACTGGGTGTGTACGGAGCGATGGTTCTCTGGTGGCAGAACC
TCCTCCTAGCCCTCCGTGCTTCACGCACGCCTATCAGCCACCACATCTGGCAGCGACTCGAGACTGATCGTACTCAGTCTCCACGTTGAAGGTGCACAGC
GCCCAATACGCGC