Description :
From Genome Similarity Track
Location :
Scaffold_1454:2595- 3881
Sequence
1286 bases(100 bases per row)
GCGAAGGCCGCCGAGGCCAAGGCGAAGAAGCGTTCAGCTTCCAGGTCGCCTCGCGGCTCCAGCTCCAAGCTGTTCATCGACTCGGGGTCTGAGGACGAGG
AGGGTGCCGTCCACGAGCCCAAGGAGCTCTCCAACAACCTCGACGAGCAGCAGCAGCAATACCACGCTGCTAGCTCGGGTGCGTATGCCAGGCAGCCGAC
TGCCACGACTGCCATCGAGTCTTCTTCAGGCGGGGATGCCACGTACCCGCAGGGCTACTTCCCGCCCGAGCCTGGCACTGGTGCGCCAGCGCTGTTGGAG
AAGCTCTCGGCTCCTCGTGGCCTTATCGGTGGGTACACCTCGAGGGGTTCCTATGAGCGTGCTCTTGTTGAGAAAGAGCCACTCTTTCTTGGCGACGTTG
AAGTCGCCCGGTGTGTGCTACTAGCACCACACAAGCTCACACTGAAGGAGTTCACCACGCTTCGCAAGAAGCCGGAGGACAAGGGTGGACTCCATCCTGT
GTGGGGTTACCACTGGGTCAAGACGAATGAGAACATGACCTGGAACGAGGTGGAAGACCGCTTCTGGCGCTACGTCCAGCGCAAAGGGTATTCCGACCAA
GAGTTCAAAGAACTCCTTGAGGATCGCACTCTGACCGCAATCCTGGACGTGCGCGAGCTCCGCATCGAGTTCGCTCAACCCGTGAGCAAGCGCAAGCTCC
ACTCGAAGATGGACGAGCTGAAGCAAGAGGCGAGAGCCAAAGCTCGTGAAGAGCGTGGGCGTGGTGCGACTACGTCTGCTACCGTGCCCCGGGTACCGGC
CAAGAAGCCAAGGACTACTTACGAAGCTGCCGCTGCTTCTCGTCCCATATCGCAACAGCCTTCGGGCAGTCTGCCTGGAGCTGCTCAACGAGCTCCCACG
AGTTATCCGACTCAGGGTAACCCCTCCACTTCACGAGCAGCTGGCGCTTGCCATGGAGCCGCCGCTCCCGGACGACTCGTTCCACGTGGTAGTGGATCTG
CCCATTACGATCAAGGAGGGCCGGCGGTGGCCTCGCACGGCCATGGCTACGAGCCTGAGGCGACGCAGCCGTATGCTGGGGCCCCGAGTCAGGTGGTGGC
CCTGCAGCAAGAGGAGATTCGTCTTCTCCGGGACCGTGTGTACGTCCTCGAGATCGCGCTTGGCGTCGGCCTTGGTGGCGAGGCTGCCGCTCGTGCTGGT
CAGCCTGGTGCCGTGGAGCGGCTCCGTGAGGATGTTGCCTCGCTCTATCAAGAAACTCGCAGTCTCCATGGCCGTGTGGATCGTCG