Description :
From Genome Similarity Track
Location :
Scaffold_199:25946- 28247
Sequence
2301 bases(100 bases per row)
CTCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACTTAAAGGACAACACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCTAGA
TCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCC
ATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAG
GAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCTGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTG
ATCCCGCTACACCACAATGGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTTCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGG
AAAAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGATGGAAGA
GAGGTGGATCCGGATCTAGAAGAGAGACCTCTCTATCCTCCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACAAAG
CAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAGCACTGTACCTAAACCTAACCCCGCTAGTCGAAGAAACGAGAAAGA
AGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCAAGGTCAAGCTGGTCCGACAAGGATCTCGA
GTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGACGATCCAAGGGAACCGGTA
AGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGG
ATATCTTCAGGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGCCCATCACCGGAGAAAGGTCGCGCACTATGGATCC
AGTGTCGTCACCGAGGTTCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCGGCGGAAGATGGGCCTGACACGTCGTCTGAGCCCCGACGCATGACTTTA
GGACCCTCCGGGGCATCCATGTTGGAAGCGCGGGCGAGGATCCGGGGACAGGAAGTCCCTTTGAACGTGAAGACTCGGGATCCAGTACGCCCTACCCGTA
ATCTGATACAATCCAGCCAGGATCAAGCCAGATCCGGCAATAAGCCAGTGGGGTTATCGTCAGATCGGGCTCAAGGTAATCGCCTCACGGATCCTGACTC
GCCAGTGGACCAGCCGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCATGCAGCGACACTTTGAAGCTACGATGAGTCGTTTCCTGGCCGAACAGGGT
ATGAGAGCGCTTGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCGTGGAGGGAGACAACTCCCATGATGAGCTCG
ACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCGGTGGTAGCAACAGCCGCAGCCGGGGCGGGTGGATCGTCCATGACCCAGAGGGTACGGATCTC
AGCCATATCGGATCTGAAGGCGTTCACGGGCAAGGATCAAGACGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCAGCCCTCATGAGAGATCAA
GCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGACAGATCCACCAGGAACAAGTGGC
CAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTAGGAGTGTCGGTGACACGTCAATACTACCACCCTCGCCGCAGATCGGATGAATCCCCGCT
GGAATATCTGCATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAAAATGGGGGATCCAAGGTACTACGGGAACACGTGGATCATTTCATC
GAGGCGTTGGGAGATGTGGATCTGGCCGACAGGCTGACCCTGTTACGTCTTTCAGACTCAGATGAGCTTGAAGAAGTGTTGCGAGCTGTGGATCGCGCGA
A