Description :
From Genome Similarity Track
Location :
Scaffold_15:259454- 261056
Sequence
1602 bases(100 bases per row)
ATATACACACGTTTTGGGACAATGGTTCGGGACTGGTTTCACCTCTTTCTCCTGCTCAACGTTACGTTCAAACATTTACCGCCCTACGTACGCCATTACT
TGCTGTTTCTCGTCGACCTGAAGGTACCTTGGATCTAAAAAAAAAACCGTCTGCTGTATGGGTGGCCATGCTAGGACACCAGACCCAGTCCCAGCGCTCT
CCAACCGGAAGGCGGTTAGTTGTCCGTGATAACTTCTATACCCGCCATGTTCTTGCTCGCGCCATTCAAATTATGATTGATGGGGAAATACGGATGTTAG
GCACTGTTCGCCTCAATCTTGTCGATGCCTGGAATAAACCGAGTCTTCGAGAAGCAATCAAACGTGTCCAAGATGCTTCTCGTGGTGTTTGGGAGCTGGT
TGCAGCTATCGAACAGGTGCCAAATTGGAGAGAGCTCCAGGAAGAACACGGAAAGTCACAAAAAAAACTAGGAAGAATAATCGGGCTGCGTTCAAAATGC
CGCTTCAGTTTGCTCCATGCACCGGTTACGTTGTCTTCAAAGACAAGAAAGTTGTCATATTCTACACGAATGACTTGGCTGATTCGTCAACGTTACAATT
TCAGGGTCCCGACAATGAAGAAGCTATTCGCGTTCTGCATGGGCTACAACCTTTGAACCGATGGATTGGAAATGAAATGATGCACAGGAGTGTTCTAAAA
GTACCCTCAAGTATCGTGGCATTCAACATATATATGAACAGTTTGGACCGTGTGGGCCAAAAGTTGAGCACCAACAGATCGCAACGAAAGGAAAAGCGGC
TGTCCATGACAATGTTTACGTGCGCACTAGACTTATGCGTCTTGAATGCCTACGGGCTGTTCTGCTGCCTTGAATGCCAGTCTGGAATGACGATGCGCGA
GTTCAAGCGCAGGGTAGTGGAGGAGTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATAATTTGTTACTAAATCCCCGTGTATTACAGTGTTATCTACTGGAAAATCTCTCTGAACACAATGTTTT
TGGTGTGCGCCGCGCCGTCAACAAAGTCTCTCGGATCAATGGCTATCTTGATCGCCTTTCTGGATGTTACTCGAGATAGGGCAACGTATAGCTGTCCGTG
TGCAAACACAGGTGATTCCAGGTAGATACCTACGTGGTGTATTAACTGGCCTTGCGCCTTGTTAATCGTCATCGCAAACGCTGGTACTACCGGGAACTGC
TTGCGTCGAAGGATAAACGGAAATTCTTTATCCTCGTCATCGCTCAGAAACACGATACGCGGCATAACACGCGTTGTCCACGTCGAGGGCCAGACATTAT
AGTCACGTCAATCCATTTCTCTCGCAAAGATACCACTCGCAGACTCGTTCCGTTGCACAAACCTTCGTCGCTATAAGATCGAGAATCATAACGATAGGAG
TGCCAACTTTGAGAACCATCTTGTGAGGGGGCAATCCTGAGAAAATGAATGAGTTCAAAACCTCGGTCTCGAATAGGTTCTGAGCTCCGGGACCGTCGAG
GC