Description :
From Genome Similarity Track
Location :
Scaffold_39:259363- 262876
Transcript NameFunction/comments
Phyca_LT1534119754Hypothetical protein

Sequence
3513 bases(100 bases per row)
cttttagaccagagcatagctcgtcgtcaacgttagttttaaaaagatgttaatatcgttagtcacgtgtacaatacgnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagaccatgaagaaaatttcttt
tcgttgatcgattttggccccagcgtagcgatcatgctcaatcgaagagcagtttctgctagagccagtctgttttcacgatcaacttcgagaagaatgt
ggtcgtccacccacacaaatgagaagaacgactcatcgtcttgttcgatgggatccagcgactttgggctctctcgagccaccagaaacgaaatggcgcc
accgaacgcaccataatgagctggtgaaccagtccaaccgaatgggagagccatatcgactatagccaagcccccacacgatccggcaaaatgggcggcc
agcttagcatccacaggtataagtcgaaatgcgcttttcacatcgccttttagaatcttgacttgtagatgagggtactggcgggctaaaacttcaattc
tgattcatattctagagcgggcaagtcagcaggaactgattttgcattcgtcgatgtctcgcaagggtacgactcgcaagggtacgacaggtcatgagag
ggtcgacgtctttcttagggacgcacccaaacgggctaaagcgaagttccgaccatcgtagagccgtcggtagttcgagaacaaggtatgtccctgaagc
ttgtccatcggaaagactgcggattaacgcttgggtatacttccgtgcgcttgtatggttccggacgtgatttctatccggtggccgtggggagttcagt
ttgtgtgcaacacctcttgttgctacagccacgaccaggtattggtgacggtacccatgcagcagaatgtcgaggcatactggatctagcgccttatttg
gtcggggatcgactgtagtttcgttgcgccatagcgcgatcgtggcggcgagcgacaaggacgttttctccactagcgtggagagggcgctgcataactc
actatcgacggaagaggtaagttgtgttgggccagttgcggacagaatgcacttcggcggtcggataccggcctgaagaaaggtcgaagccagccgatcg
cagcggttgagctcatgctcgtgcaatcggcggtgaagattattctgtaactggcgaacggtccccggtgtgacacgaaacggcaagcaactcggtcggg
gtatacggtccggtttcttcggcgcctgtagtatgaacggcgaccttgaacgtcttgagtaggagttgggcatggacttgttgaacattaacgacactga
acgaccaggataacatgaagacggacaagatgcttggccagataaactcggcgcttggggctttggtggccatcattggcgcagctcttcgcgcaatccc
cccatctgtgctgagatgtacttgcgaactaccggtggtaggtcgtctggaatgaagtgggcgtggtttggaaacgcacaccggtcatcgctcttggacg
tgcaacctcgtgacgatagatgcttcatgcagaccgagagtcgaccttgtttcggcaacgcatcaaggacgtcttgaggtgtcttcctgaccgaacgggt
tgtctccatccgacgtgttccaaccgaaagggaagatggtaacgttcttgccgtcgcctttgttgagacagctgccaaggacgctaaacgttctgtctgg
ataacgtatagtacactttgcaaatccgggtcttgcagggagagcctccggcggatttccgttcgtgaagtcgttccatgacgggcgtccatctcggtgg
cagctctgtagtcttcgaacaagcggtcgaaccagaacgtgagagttgctacgtcctctgagctccattggcagaaactacgtagttcttcgacaaactc
cctcgagccgctgatcaaccgacaagtgtggtggtcgaagaattcttccgcaaatacgagcaggaccataagtgcatttgagatatcaccaagggactcg
ggtttccgtgccttcggcatggccactgaggttgagaaattgctgaggtttaccgaaccgtctgcataccacgcccttcgcgcagagaagtcgaatcgcc
agaagtgcatgattgaaaggcctcgggctccaaactggatgtcgtacacacgggtaatgatggctgggtgtggcttgaactttgtggaccgggatgaaat
catagaatcaacaatatctgaaggatccttacctgcgtggtccggtccagcgattataccatggatcagttgctgtgtccgggtcggattgaaggcgttt
tttgatcgtcgttcactaggttcggaaacgtcgagcaggtcagacggggctaagacacgtcgtcgttgggactcccgttgctctgtcgacggagcaggtc
gttttcccggttctttttgactaagtcccagataaaagcgaatgagatcggggtcatccgcaatggcagctagcattttggcgtggcagttctgtgggac
aagtgtctctgtactggatagcgctggtgcagctggatacgtcgcatttggattcggagagtcttcgggtactatggcgccacctccgatcgactgtaac
agtgtctcgagatcgtcccgctcgttttcttcaccgctaggctgttccgtcgtctcgtttgtatggcgaggatcagcatcaaaaacgtcgccaatgttgg
cacgtacactagcgggtatgcggcgatttccgtcgacgaagaacgcatagtcaacggcatggcgtacactcactgtagactcgaccccagttagggtgtt
agttcaccgcagtgtatcggtggcttggggctgttcacgaactggtcgaaatcccgcgagtaggcgcggaatcgagcgtgatcctcgttgattggtccca
agaattctgtccaaaatctcagtatactgttcggtcaactcctctggattcatatcctcgactcgcatacggcttttaccgatcagaaaacacaataccg
gtgcgacctcttctaagtccaccgttcgagagttaaattcaccaagtagcgttcggatggtgacgtagtttccgttgtatcttacaacctggccggtcac
gtagtttccgttggagacaccgacaacagatttacggagccattcgccgggagcccccgcgtcgtactcattgacgctaacctggcgacgacgtgccgtt
gaggctgaaacctgcacaactgcatgcgaggtgtcgacaactggacagtagcggtgctgcctactatagtgtcacatgttccgtactgaggaacaggcac
tacggcttggtcctggacatcttctggcatgaggagtacggggaagggcgacatgaccatcgtaataggttcgtaggtggcagaggtgggtgttttcgac
gaagtaaaatcgg