Description :
From Genome Similarity Track
Location :
scaffold_9:259296- 267835
Transcript NameFunction/comments
g4521.t1hypothetical protein

Sequence
8539 bases(100 bases per row)
TCGTGGGATTCGCATCACACCAGTTTGCCAGCTGATGATCGGGTTGAACTGCACTAGCCAAGGATGGCCGAGAATCACGACTTGGTTCGACGATACCTCC
CACTCGATGAGGGAAACATCAGCGAATTCTCTGCCGTCAAAGCTCAGTGTCTCGCAGCAGCGGTGCCGTGCGGGCAGGAGTCGTAGTACCGTCGAAGTGC
TCCGCAGTCACTTTGGCCGCATCACGAAGTGTTGAGCGAGGCCAGGGCGCACGATGTTGCGTTCTGCTCCACTGTCGATCAAGACACGCACCACTTGGTC
GTTCATCATCCCTTCAAAGCGCAGTAGCTCGCGTTTGGACGGAGCCGCTGTCAACGGACACCATGAGTTGTAAGCTGTCAATGACTTCAACAAGGTTGTC
GTTGTCGTCAACAAAGTCCTCTTCGTCGTCGGAGTCGTCTTGGGCCTCGACCACGCAGCGGAACGAGTTCTGGTTCGCTCTGAACGAGCTGCGTCCGTGT
GGTGGCCGGGAAGGACCACGAGGGCTGTTGCGAGCCTGACGCTTGCGGCAGTCAGCTAGACGGTGACCAGGCTCCTTGCAGTAGAGACACAGGTTTCGCC
GCATACACTCTTCACGGGAGATGATGCGAGCGTTGCCGATCTCCATTGGAGTTGGTTGCTCCTCCATGCGCTGTCTGAGTTGCGGAGACGAGCGACGTTG
CGACGACTGGTGTCCTGTTCGACCAAGCTGCCGTGAAGAGACGAAGTGGGTGCGGTCGTACATCAGCGCGAACGAGATTGCTTCGTGGTGGTCCTGAACT
GCCTCAACTTCACCTCTTGTTTGATGTCAGTCAACAGACCCTTCTGGAAGTGCATCACCTTGTCGATGTCAGACATGTCTTCCACCTTGCAGATGAGGCC
TCGGAAAGTGGCGACGTAGTCTTCGAGACACGAGAAGTTTCTCTGGCGCAGGCGAAGCAGCTGGTCGCGCAAGTGTTCTTGGCGATCCGGCGCTGTGAAC
TCGCTCGTCAGAAGTTCTTCAAACTGCGTAACAGAGTGCAGAAGTGTCATCGTGGAAGACGTACTCACGATACCACGCCGCAGCAGGCCCTTTCAGGTTT
GCTACCAAGAGAGACAGCGGTCGCTGTTGAGGCGCTTCTGACCCATACTTGATGTTCTTCGACTCGAAGTAGAGCTTGGCGCTGAACATGTAGTCACCGA
CGTCGTCTTCTTTGGTTCCCGAAAACTTGGGCATGGTGATGCCCTCAGCTCGGTATTCTCGAGTGTCGACGGCAGGAGACTCACTCTGCTGCTGTTGTTG
CTGCTGAGGTGGCGCCTGTTGCTGCTGCAAGGTTGCTGCCATCTGACGCTGGAGATCGGCCGTCTGCGCCATAAACTGTTGCTGCTGCTCGTGCATCATT
GCTGCAAGAGACGCAAACAACTGCTGCATGCTGTCGCCGTGCTGCATGGGTTGTTCGTCCATGATTGCGCCTACGCTAGCACGTCGTCACTTAGATGACT
GGGGCGCGCAAGCTCCTCAGCCAAATCAATTAAAGTTGGAGCGAAGTCACAGACACTCCCTGGAGCGCTGCTTCCGGCAAAGCCTGAGGAACCCAAAGCC
GACGCTGTACCCTTTTCCTGGTACACCCCCGAAACCCCAGTCCTCTCTTAAACGCCCCTGGCGACGCCAACTAGGAAGACCGGGTGCGACCCTTGGTGAG
AGCACACGCCGACTGAGTGTAGTCGACGAAGCAACTCGGAGAAGCGGCGCACCGGCGATGCTGATGGCGATTGGTCGCTACGGGCCAATTAGCGGTCGAC
ACGAAAATGCGTGCGACAAGGCGGGTCTGCGCAGATGGATTCTCTTCCCCAGAAAAGAAAAAGGCGGCGCGGCGGAAGCAGACAGAGAACGGAGCGGTCG
GATGAGCGGGCACACGCGCGGCTGAACGGACGAGGAAGGCGAGGGCGTACAAGCGTGGTGTACGGCCTGGCAGGAACGGAGGCGTGCGTGGGCGACGCGA
GCTGAAGATCGGACGGACGGAGCGACTGGAACTGGACGGGACGAAGCGTGCGCTGCTACCAAGTGTAAGGTTTGGCTGGGGCGTTTGTCTTTGAAGGCAG
ATTGAAAACTGAATTGATCTTATGTGTGTGTGTGCTATCTGTCTACCTACGAGCGCGCTGGGAGCGCGCTCTTGAACATGCAGTGGTTGGCTATGGTTCG
CCGTGGCGCGTGCTTGCGCAACCTTCGTGAGTATGCAGATGTCGATCTCGGCTCTCTGTGCGGACTCTCCTGGTGATGGCGTGTCGCTCTGCTTTTGTAC
TTGCAGATCGTTACAACCTTGCTGTGCCCATTTGCTGTCGCCCCATCCGTCACTCCAGCCGTGCATGCCTCTGAACAGTGGTCTTACAACCACTTCACGA
CTTCGAGGTGGCCATTTCGCGTCATATCGAGACACTCCAGTGGCTGCTGGAACAAGATTTCGTCATGGAAGACAATGCTGGGGTTGAAGTGAAGGCAGCG
GAAAAGGGACATACTAAATATTGTCGCTCTTGCCAAAACCTGCAATCTGTATACCAGCCCTGTCAAGGGTGTCGAATTCGCAGTTGTTAACGCAAGCCTG
CTCTTTGCATGCATGACAGCAGAAACATATCTACACCTTTTACCAGGCAAGTTGAGCACTTTCACAAGCAAAACGGATTTGGCCAGCTTGCGCAACTTAA
TAATCTAACGAAAAAAGGACGCTTGTCAGGCAAAGTGGTTTTCTGATATAATTTTCCCGTGCAAAGTGGTTTATATCAAAACTACTGTCCACCGACAAGT
CGCTCAGCAGTCTGTCTTTCATGACGGCCATGGTCATGTCCGCCTGCTCGTCGAGGTACTCCTCGAGCTTGGACATGACCTCGACCGTCATCTTGATGCA
CGCAGTCCACACGCCGCCACGCGGCTGCTGCTCGATGCTGCCCTTAGCTGTGATGCGCCGCGCAGTAGTGACAGACACAGCATTGCTAGCCGCAACGCCC
AGCCAATCATGGCCTGCCAAAAACGCGTCGAGTACGCGCTTTTTCGCGCTGTTGCGCTCAAACTGCTTGGCTTCGCGCGATACAAGGGGCGGTGTCTGGG
GCGTCGCAGACGTGGGCGGTGGGGTCATTGTTGGAGAGCGGCTTGGGGAGGCTTGGGGGGAGGAGGTGAACACGCAAATGAAGGAGTGTCTGCATGGAGA
CCATGGGCGGCTTCGCCAGTATCAAGTGGCTCACGTTGCTTCCACACCACTTTGGTTGGAAAAAATATGGCGCCAAACGCTTTGGCTGTAAAACCTTATT
TTAGGTGAATTAATAAAACCTCGATTGACCGTTTTGCTTGTGAAAGTGTTCAACTTGACTGGTAGAAGGTGTAAATTGTAGCCTCTAATTCGCAGTAGAA
GCCGAGATATCGGCAACGATCCGCTCCGAAATTGGGGGTCCTATCGATTCGGCGCGCACGGTACACGGGGCTCTGCTAAAACGGTTGTTGAAGTCCCCAC
GCCGCACCGGTTTTGACGCTGGGTCCTCGTGGCATGGGGAGGAGGTATCGTGCAAAACCGTGGTGACCTGCGCACAACTGGGGTGTATCATTTGTACCCA
AGACACAGGTGGTGTGGAGTTTGCAGGTTGTCTGTGGTCATTCAGCATTTGCCATTGCAACGATGGCATCTCCCCCACCTCCACCTCCTACTCCGCTGGT
AGCTGCGTCGATTCTCACCAGTTCCAAGCGCGAGTTGTCATCGTTGTTCCACATCACTGAAAAGGTTTCTTCCTTCCTGGACACATCGGTGGAGCTTCCA
CTGCATAAAGCCTGCACGTTCGGCTCTCTGAAGCTATTGAACCGCATCTGGAACAGTACAATCGACCTGGAGCACGAAATCGAGCCATTCTGGTCTGTTC
GAAGCTTTCTCCGCTCGGACAAGCACTACCAAGATTTCCAGTTCACGGCTTCGTTAGTCGAGGCAGTGAAGCAGAGGAATCTCGAGATGGTGCAGTGGCT
CTTTGAACATTTTCCCGAATGGGGTGTGGGTCGGGAAGTAGTTGAGGCGGCGGCAGAAGTTGGAGCTCTGAGTATCCTGCAGTTCTTCGGCCAAAACGGC
AGGAACCTCAATCCTCATGATGACGACGAAGAGGATGAGGATGAAAACAACAGAGAGCAGCGAGGCATCGACTGGGGCTACGAGGATGCGACCAAAGCGG
CCGTGGCTGGTCATAGAGACGTCGTTATGTGGCTTTATCAACACGCTGGAAGCTACACGAGAGATGATCAGAAGACAACGTTGGCTGTTATTGCCAGTGG
AGATGTGGATTTGATCCAATGGCTCTGGGAACGGCTCGACATGCCGCCTGGTAATGGAATGCGTGAAGCAGCAGCGAACGGGCACATTGAAATGCTGGAG
CTGTTGGAATTTCAGGGCTACGGCGGCATTGACGTTGGGCAGCTCGTGAAAACTGCTGAGGCTGGCCAATTGAATGCTGTTCGATGGACTATCCGAGATT
TGGATAGACAAGATCGCAATTACCGTGATTGGGGGGACTACGGATTCGCTCTGAGATCCGATTCAAATAGTGGACGCGTTGAAATTACCCGCCTCGGTTG
GGAAGCGGGGCTTGCCATTCACGCTGCTGCAGTGAATGGACACCTGGACGTTGCGAAGTACCTCTACGATCGCATCGACATTCGACTTGATTTTGACGAC
AAAGTGCAAGGCGGCAGAGGTCCGAACACCTGGATGAAGGTGTTGAAAAAATTGGAACTTAGATCTGAAACCAATTTATCAACAGTCTCAAGAGATACGA
TGGTGCTTGCTGCGGAGCGAGGCTTTCTCGATGTTGTCCAGTGGCTATGGGCAGAATTTGGTGATGACCCAACGATGAATCTCTTGTCTGCGTGCACAAA
CGAGCAATCGAGGTACCACGATTGTGCACTTGACGCAGCTGCTGCTACTGGGCACTTGGCGATTGTTCAGTTCCTGCATCAAATTGGCCAAGATCCAGTC
CTCGAAGACACCCGCAACCTGAAACGCAGACGGCTGCTCAAGTTCCCAGAACTGTGCTGCCATAGAGATCCAGGTTCCAGCTCTGCACAGCCATTGGGGC
CTTCCCCACCAGGGACGCCAACCTGCACGGTGGCAGCAATGGATCTTGCTGCAGCCCATGGCCACCTAGACGTCGTTCGGTGGCTTCACCATAACCGGAC
GGAGGGCTGTACTACAGACGCCATGGACTATGCTGCACGAAATGGTCACTTGAACGTGGTGCAGTGGCTCCACCAACATCGCGGAGAAGGATGCACTCCG
AAGGCAATGGACGGAGCGGCGACTAACGGCCATCTGGATCTAGTGAAATGGTTGCACGGTCACAGAACGGAAGGATGTACTGCGGCGGCAATGGATGGAG
CAGCTAGCAATGGGTATCTTGATGTCGTACTGTGGCTCCACTGCAACAAGTCTGAAGGTTGTACGACTGTTGCAATGGACGGCGCCGCTGCTTGCGGGGC
ACTTGATGTTGTAAGGTGGCTGCATCATACCCGCAGTGAGGGCTGCACGACAGCAGCGATGGACGGCGCTGCTGGGAATGGCCATCTTCGCGTTGTTCGG
TGGTTGTATGACAATCGCGACGAATGGTACTCAGTAGCAGGCATGGACCAGGCACTTCAAAGGTCCGAGTTTGAATGCTTGGCACTACTGGACAAGATAA
AGCGAGGAAGTTTGACCGCTTTGCGAGGTGTGGCGGACTCAGGCGTTCGTAGATGGCTTCTTGAGCGGTACCCCGAATACAGGTCTTGGTATTATTGATA
AGCTGGCCAAGAGTTCAGATGGCTGCACGACCAGCGAAAGTTGTACGACAAGTGATGAGCAATGTCATCTTGAATTTCAAATTCGACTTTGCTCTCCCTA
AAACGGTTGGATCTTTGAGCGTAGTCAACATTGAGTAAATGCAACCATCGACTATTATTAAGATTGAAATCGAGCTGCCTTTGATCAATGAGAACCGTTC
CGAAGGCTGGACACCCAGCGCAGTAGGAAACGTTGCAGGCATTTCGAGATCGTGTTGCTATTGTACAAAATAAGAGACGAAGGCTGCGCGATCGAGCTGG
GAACAGATGAGCTTCGGATGTCTGAGATCCCCAAGTGGTTGATGAGTCACTATCATAGTGCCGTACGAGCTATCGTTTTCATGAAACAATTGCACAAAAG
TTACTTCCTCTACGAATGCATTTGAAATATGTATGGATTCGATTGGTGTGCGACACACATATTTTGCCAACAATCAATCCTGCCAGAAAAAGTCGAGATG
AACTCGTAGACCAGCGCTGCTCATTGTCGTGAAGCTGCTGTTCCGCGCCAAGGGCGAGTTCTTGAACCTTCCCCACGTTGTGGCTGCAGTCTCTACGACC
CTGGACTCTGCGATGGATTCACTCCCTCTGAACGAGGCGTGCAAGCGGAATTCAATCCAGCTGCTGAGTCGGATTTGGGCCAGCAGCGAGATGTTCACCG
TTCGCAACGAGAATATGGCGCAGCTCTCCTGGACGCTACGGAGACTTGTTCGCACGGATAAATACTACCGACAGTATCAGTTCTCACTGTCGCTGGAGGA
AGCTATTCGCCTACACAATCTAGAGATGGTCAAGTGGCTCGCTTCTAGGTTCCAAGGCTGCATGGTGCGTGAAATACTGTGAGTCAAGCAGTTGCAACGG
GGTCCATCCCGTTGCTGAAGTCTTTGCTTGAAAGTGGCAATAGTTCAGTGAATCCAAGTGTTCAAGCTACAGACGTGGGTATTCGTGTTCAGTGGAGCGA
GAAAAATCTCTCTGACGCAGCGTCAAGTCGGCGTAGTGACGTCGTGTGGTGGTTGCTTGAGCACTTTTCAGATGAAAGTCACGACAAAGACAGATCTCTG
CAGATTGCAGTGAATAATGGTGCCGTGCCATTGGCTGATTGGTTACTCCAGCAAGGTGCAAGATGGCCGAGAAATACACAAGGCCTGCAATTGGCGCACT
CTGCGGCAGCTCAAGGACGTATCGATGTGCTCAAATGGCTGGCGAAGCAAGGTCACGTGGAGGGGCTTATTGGACTGGTGGTGATAGCTGCAGATAAAGG
AGAACTCGATGTTGTCCAATGAGTGATCAATCGCGATACACGAAAGAGTGGCGGTACATATCTCACTGACTAGGGTGGGGAAATTAGCCTCTTCATTCAT
AGTGCTGCAGTGGCAGGCCATTAGAAGTTGCAAAGTATCTTCGAGCACGCACGAAAAGCCGACGGACAGCTTACAGCGCGCAGTGGAGCAGGCAAAACAA
CGTCGGAGCCTCCAAAAATTGTCTATGTACCTCAGTTACTACGACAATTCTGGAATAGTACCAGGGAAAACGATGGCGGATGCAGCGGAGAAGGGTCGTC
TCGACGTGGTTCAATGGTTGTACGCAGACTACGGCGAAGATCTTCATACTGACTTGTTTGGCTATGGTGAAGCGAACATGTGAGATATTTCGATCGCGAT
GGATGCGGCTGCAAGCAGTGGACATCTTGATGTGATGAAATATCCGAATCAACTACATATTTTGATTTAAACGAAGGGTAAATGAAATGATTGCGAAAAG
GGATCCAGTCCAAAAAGCACGACGGCAGCAATGCATCTGATAGCTGAGCATGGTTACCTGCAAGTTGTAAAGTGGCATTTCCTTACAACAGAAAGGAAGG
CTGTACAACGAGTGCAGTGGATGCTGCGGCAAGACGTGGTAAGTTACAGATAGCCCGGTGGCTTCATGAGCACCGCTTCGAAGGATGCATGGCAGTAGCA
ACGGGAGCAGCGATGGATGGTGCGGCAGAGCATGACTCTCTGAAACTGGTAAAGTGGCTCCATGAAAACACCAGCGCTGGTAGTACGACCAAAGCATTCG
ACCAAGTTGCCAATTTCGGGCATTTTGGCGTAATGCAATGGTTGCATTTGAACAGGTCAGAGGGTGTACACCGGATGCAATGGACGGAGCTGCTGAGAAC
GGCATTTGGAGATTGTAGAATGGTTACATCAGAATCGGGTCGAGATGTGCACGCAGCGAGCCATGATCAATGCTGCTAGTGGTAGGTCTCTTGATGTTGT
TCGCTGGTTGTCTGTGCACCGAAGAGAATTTTTTTTTCCTCTAAAGGTATTGATGCTGCCGCAATGTCCGACCAGTTCGAAGTATTGCTGTTTATGTACC
ACGAACTTCACGCAAAGTTCACTGAGGAAGACTTAGATGGCATCTTCGACAACCAAACACCCGAAATTCAGGCTTGGATCTGCGAGCATTATCCAGGGTC
TCGATCTCAAATGAACGACGGTGACCTCAATTTTAAAGTCGAATCACCAACCTTGCGTGATTTTATTCCAGTGCCAATGGCGTCGCCTTTGCTTGAAGTA
AAGCTGCTGTTTGCTCGATTTCGATCTGCTTCTCGATGTCTCTCTTCCTGGACGCTGCAACCCCAACCTAGCCTACAAGTTTGTACCTACAGAGTTTCTT
GCTCGCATCTACAGCAACAGTGAAACGTTTGCAGACAGA