Description :
From Genome Similarity Track
Location :
Scaffold_174:25921- 27969
Sequence
2048 bases(100 bases per row)
GTATGTTGCTGGATCGAGAATATCCTGCATGTATAACGGAGCAGGATCAGTGATCTCACCCGCAGCCAGAAGTCTGCGGTGTCGAACGATGAGATCGTCT
AGTTCCCCAGCGTGATGCAGCGTGCGCAGCTTCTTCAAGACAGCGCTGGCGTCCAGTGACTGTATGCCGCACTCGCTTAAGATCGTCACGACGTGTGCTT
CTTCCTCCAAGCCAAGCGATATAACATCATCACGATACGATGAAATTTCTTCATCAATTTGAAGCCTTCGCTGAGAACAGCTTCATGAAAGCGACCAGTG
TCTTTGCATCTGACTTCTTTCTCTTCTCGCCGCGGACGCTCCCCAGCCGCGGCTCCTGCGTACCATGTGTACCACTTCACATGTAGATGGGTGACTGACG
ATTGTTTCCTGTGCTTGGTGGAATATAAGACATCAACTTTCTCGCTTGGTCTCTTTAGTTGTTTGATAGGTCCTCTCAGTTTCGTCTCCAGCCTGTCCAA
TCGCTCGTCTTGTCGAGGTCGCCTTGAATCGTCCAGCTTTGTCTCTAGCGCATCCATTCGCTCGTCCCGACGTTTTGCGTACGCGATGAAGTGCTCAATC
ACAGAAGCCTGGTGGCGAATTACTCTGTGATCTTTGTTCTCTGTGCTTTCTTTGTCGCATGATATGTGTTCTTCTTCTTGCGCATAGGAAACTTTAGTGG
CGACGAGATGTGTAGATCACGCGTATAGCTCCTGAACAGTGCATTTTCTAGCCACCACGCATTGCTCTAGCCACTTGACTGCTGGGCCGTCGGGATGCAT
CACCTTCATCAACGGGTAGTGCAAGATCAGGTACGCCGTGATAACGTCCAGAGCCGAGCTTCTGGCACGTTGTGAAGAGCAATGACTGGACTTCTGCGAT
CTTGACCTAAGCCTGCGCGCCGAACGTGCTCGGATCAGCAAGCAGCACCTTATCGGTCGGCTTCCTACCGCTCAGTACCTTCGATACTTTGTGGTCCTCG
CTTACCGTGCTGAAGACATACTTAAATGCCTTCTTCGCAGTGCTCATGTTCCGCGCTCCGCGATCGAAGATCCAGCGGGATGTGATCTGGTCGGAGCTTT
TGGCATGCTAGGCGCCACCACGGCTAAGTGAATGTCACTTCAACTACTGTTCAACTCCTGCACTCTTTGTGACATGACCGAGGAGGCGGTAAACGTGGGT
GGAGTGTCGAGGACATGGCTGGATCGGTGGTGATCGTATCTTGGTGTTCAATGACGGTGGCTGGGTGGTCTAGAAGGTCGATGAGGGCGATTCAGGACTG
AGCACGACGCCGGTACTGGGAAGCTGTACTGGGAGGTTTTCTAGGAGGTCGGCGTGTGGTGCTGTCTGGGTGATAAGCGCCAAAGTGATCGCGTATAGTG
GACACGCAATAATGTCAGTGTCGGGGAAGATATATAGCCCCTGTTCTTCACACTTCTTCACGCTACTTCACACAGATTAAGTGCACAAAGAACACGCCGC
CAGCGTCGACCGATACATTCTGCCTGGGAACAAGTAATAAGTCCGATTCACGTCCAAACATGTACCACAAAAGACTCAGGAGCGCTCCATCTTGGTAATC
GCTTGAAGAGCAAGCATTAGCGTACAAGTATTATATCATTTTTTGCAAGTCACTTTTGAACATGCAATAGCTTTCTTCACGAATCCTCCACCCTCTCTTT
TCACACAATGATAATATTCAAGAGTTGTTCCCATCTTAGACATCCGTACTTCAAGCATAGCTCGAAGATGAGGGAATTGTTCGAGTAGTCAGTGCTTTAC
TTGCCTGTAGTACTGCATACAAGAATGTCTGGCAAGTGGCTTGCCACACTTCCCTTCGTGAAACGCAAGATACACTCCAAACTTATCCATTACCGACAAA
AAACATTTTCCAGTGACATCACGCAAAACACAGCTCCTAATATACTTAAGATCGACATCCTCAGACTGGATGAATCTCAGGAAAGCATTTACAGCAGTAG
CTATTGCTCGCTTGGTGTTCCCAGGCAGCAAGATCATCCAAGCCCATG