Description :
From Genome Similarity Track
Location :
Scaffold_3:2591833- 2594261
Sequence
2428 bases(100 bases per row)
TATGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACGCGTCGTTGCGGACGGCTGTGAAGTCGCCACACA
TCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCACAGAGTATAACTTCCGGGTTGAGTACAAACCCAGAAGACTTAATGTGGTGGCCGACGCGCTCTC
GCGTCGACCTGACTACGCCACGTCTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCGACGTCGTCACTGCTGGACGACGTGAAGGTC
GCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACCAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTG
CACATTGTTACCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACAACGCGGTCCGCGTTGTCGTGCCCAATGACCATGACCTGCGACTCAG
GATCATGTACGAGTATCACGATGCACCGACTGCGGAGCATCCGGGCCGTGAGAAGACATACCTTCTTCTCACGCGAGACTTCTACTGGGCCCACCAGTAT
AAATGGGTGCGCATGTACGTCCGTGCTTCCGAGGTTTGTCAAGGTGTGAAGCCTGCGCCTTTCGCGCAGGCTCCATTGCAGTCACTACCAACTCCACGGG
AGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTTCCCCAGACAGCCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACCGCTTCAGCAAGAT
GGTACATCTTGCTGCAGTACCCGCTGAAGTGACTGCGAAACAGACGGCACGTCTGTTCGTTGACATGGTGTTCAAACACCATGGCATGCCGATCGACATT
GTGTCGAACCGAGACTCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCACCCGCAGA
CGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTTGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGTCTGCCGATGGCGGA
GTTCGCCATCAACAACTCGGTGCATGCCTCGACTGGGCATACACCGTTCTACGTGAATGCCATGAGGCACCCACACCTCCCGAGTCTACTCGGGATGGTG
GCTCCTTCCTTAAGTGGGGGAGGATCTCCAACTGCAACGCAGCAGCCGCAGAATGCTGCTGACACTTGCACAGTGTCAGCCGCAACGACACGATGTTAAG
CCGAGAACCGCGCGTCTGTGTGGGGCACAGACGCCGACAAGCGCACGAAGAACGTGTCTGTGCGAGGCGCAGACACCACCACCAACAACAAGAAGAAGAA
CGGGTGTGTTCGGGGCACAGACACTGACAAGAAGAAGAAGAATGGGTGTGTGCGGGGCACAGACACTGACAAGAAGAAGAAGAACGGGTCTGTGCAGGGC
ACAGACACCGCGAAGACGAACGCAGAGGCCGGGCCTACTGCTGAAAACGAGCTGAACGAGTTCAGCTCGGATGCAATCAACTTCGTGCAGCGCAGACAAG
CCGTCATTCGGTTTGTCCAAGACGCTATTGCAGCTTCTGTTGATCAACAGAAGCTGAACGCAGACAACGTTGGCAGGAGCAACACAAATGAATTCAAGAA
GGGTTCATTGGTTTTGTTAGCTACTCAAAACCTGCCTAAACATGCAGTTTCCGACTTCGGGCGAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACTG
TGCTGGCACGGCACGGCAACGCCTACACATCGGACAAACCGTCTAGTATGCGCCTCCATCCGACGTTCTACGTCGGGCGGCTGAAGTCATACCTGCAGTA
CGAGCTACCTAGCTCGGCTGAACCGAAGCAGAAGACTCGGCGGAAGCCGTCATCCTCACCAGCGCGAAGTCGCGCTGGAGCAGCGGGTCGAGCTAATGGT
CCAGCTCGGCCGGAACGATCGAAGCGGCCTGGGAGGCCGCCGCAACCTGAGGATACTTCAGAGCGCCGAACCCAGCGCTCTGGAACTACTCCACGACCGG
AACTCGGTCGTGGGGAGACGCGAGATCAGGGTCAACACCAAGTTGACCACACACGAGGCGTGTCTCCACCACCACCACCAATTCGTGACGCACACGGCTC
AACTCGATGGATAGTTGAGCGGATTGTTGGTCATAGTATCCCGAGAACGAACCGTCAATCGGTTCGTTTTCGTATCCGTTGGAGAGGATTCCCTCCCAAC
CAAGATACATGGGAGCCGCGAAACGTCTTGCTCGAAGACGTCCCGGATATGGTGAGGGCGTACGGAGCCCACCATGCGCTACACGCTGGAAAGTAATACG
AGCGCTGTTGTTAACAACAGCGCCCGAA