Description :
From Genome Similarity Track
Location :
Scaffold_370:25918- 27166
Transcript NameFunction/comments
g12099.t1hypothetical protein

Sequence
1248 bases(100 bases per row)
CTCGCAGTCGTTGGCGTTCGCTTCGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTGATGGAGGGCCGCATGCACCGCGTGGTGCATGTGCTGTGC
CGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGACTTGCACGG
CATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACAAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGC
TTCTCGGTTCTAACAACGACACCCGTTGCTAGTCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTC
GAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTG
TTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGCGCGGGGCGC
CCTGCTGGTCCCTCTAGTTTTTTTTATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCTTCGCCGCGTGCACAGGTGCTGTGCACTCGCGAGCGT
AGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGGACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGG
ACCTCCCGACGGCCTTTTCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCA
ATTGCAGCCTCGAGAGTATTTGGATACCCTCGGAAGAGATAGATCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGT
CAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCT
CGATCGGAACTCGTTCTGCGGGGGCTCAAATGCTAGTTTGAGCTCCTCCTTGAAATCCTCGTACGTGCTAAAGCACGTAGGGTCTGTGAGTCGGCGTCCG
TACGCCCAACTCCTTTCTCGTCCGCCAAGACATGACATGGCGAACGCA