Description :
From Genome Similarity Track
Location :
Scaffold_272:25916- 28621
Sequence
2705 bases(100 bases per row)
ATATTCTATATCTCTTTCAGTGGGATACCATCCCGTGCGTCTAAGACACAGGAAACCGAGTACCCTCCGATGTGTAACCCCTTTACGCCCTCCCCCACTA
GACTGCCGTCGACCCAAACGGCAATCGAACCTTGTTCTTCAACGAGGTCACTGCGCTTGCGATTAATCTCACGGAAACGCAAAGCTTAGCACCATGTCCT
CATCGCCTAATGAGTGAAAGGCTCTTTGTGCATACCTCGGGATGGAGGAGTCAGTGGACTATGGTAGCAATACCAGTGCCTCGGTGATGCAAGGACAATG
TCCGATACACCCCTGTCTGAGGTACATCCTCCGACTACTTTAAGTCCGTTCGCTGAACATGATGATGCAATCATCACCAACCCGCTCGATGAGAAACAGG
AGTTGGCTATTCAACGAGAAGAAAGCGCTCGTCGTCAAGCGCAAATGGTCACAACCCTTAGGAACCAGCGTGACTATGTGTTCACCCCACTCAGTGTGGA
GGAAAGTCTTCGTCAAACGACTGGCCAAACGTTGGCAACGTGGACCATTGGTCCTGTAGCTGCTTCTCTCGAGGAAGGGCAAGTGGCCAGGCACTTAGTG
AGAGGTTCCTTGATCCATATCTGACAACGCAAAGACAGTACAAGGCACGCCTTGAGATGCAAGCACGTGGTGCACCGGTTCCACTGATTAAGGGCGTACC
CATTCTCTTGTCCGCAGGCGAAACAAAGGACGAAGAAGACAACGACTTTATTCGCTGGGTGCACCGCACTCGTAATCTCCGCAGTATGTACGCTCTGAGC
TAGTGTCAGTGTGGCCGGTGTGCGTCTCGAACGCAAGCTTCGGTATGATTATACAATGCTTAAGGCCAGAGGCCAATTGCAAAATCGCACGCGCTATGCT
TCGGCTACTACGGAAGCCGCGATTGCTGGTCCGGCTGTGACCAACAACCCGACAGTCGACACCACTAGTGGTGGGAAACGGCCTCGGTCTCGAGATGACA
CTGGCCACGATGTTCAAAAAACATCCACGGCGTATGGGCAGTCTTGCCGAAGGGGAATCTCATACTCCCATGAGTTCTACGACTCCGGGTACCCACTCCA
CTTCACCAGATATTGGTATTGGCCATGACGACGAAGTCGTTTCAGGAGTCTCTCCACATGGAACTGGCGGTTCCCTTGCTGATCGAGCAGCGTCGGTGGA
GGTCGGTGTACCGAAGGAGGGGCATGAGAAGGTGCTTCTAGAGCTGAATGGTCTCCGTGAGACATTGGGTAATACCCAGAGTGCGCTCGACGCGACGCAA
GCTCGCGTTCAGACGTTGGAGTCGGGTCGCACCCGGATGGAGGCCCAGCTTGACCTCCTGATTTGGATGCAGCAACCGATGGCAAGGCCAACTTCCGCGG
CGCAAGCGCCTCCAAGTTCACGTGGGACGGATCCCGATACGGCTTAAGCAAGCCCACGTAGAACACCGGATGTGTGCGCAATTTGCGTGGAAGGTTGAGC
GTATACGCAAGTTCCTTCTTGGTCACGACCGTAAATGGTCCAATGCCGAGGAAGCAGCTTAGTCTTAAACACAGCAAACACTACATTTGTAGGTAGGTTC
TTAGCATTTAGTAAGACTTGATTACCGACCTCATAACTTTCAATACAGCTTCTGCCTTTAGTATCCTTTTCTTCCTTCTGTTTGTTCTTGCTATCAGCCG
ATGCGTCATGCACATGTCGTCAGATATTTAATCGCGCTGTTAGGAACGCGCAACCTTTTTTTAACAGTATAAGGGCTGACATCAGCAAGCCAATTGGCTA
CCTCTCCCCCACCCAAGCCCAAAGCCACGTACTGGTAGCGTTAACGGAACGCGGGTGTGTGTGAGGCCGTTTACGTTGTACGGAGTATAGCCTGTCGAGG
CATGGACGGCATTGCTCAACGCAAATTCAACAACAGGGAGCATGGAGCTTCAACGCATAGGCGTATCAGTGCAAACACTGCGTAAAATGTCATTAATGAC
GCGATTAACACGCTCAGTTTGACCTGCGGATGATCCGCTGTGGACATGTCCAAACGGGTGCCGAGCACCTTGAAATTGACTTCTAAAACTTCCCAGTGAA
GCGGGGATCTCTATCAGATATAATTGCCACTGGCAAGCCATGTTGTCGAAACACACGGTCGATAAACATCTTCGCTGTACCTTCGGCATCAATAGAGTCC
GGCACTGCCGCTAGGTGAGCCATTTTGCTCAAACGGTCAACAAAGACCGCAATGCCAGAGTTGCCTTCCGAATATTTTGGTAGGCCAAACACAAAGTCCA
TACTCATGGACTCCCAAAACCCAGAGGGTACAGGCAGACTAGCCAGCGGCGCCGCAGCATGTGCTGAGGTTTTCACCCGTTGACACGTTTCACACGTACG
CACATAGGTGCTCACCCACTTGTATAGTTTGGGCCACCAATAAGCCTGGCTCACTGAGCTATAGGTCTTCTCACGACCGAGATGACCACTTAAAGCGGTA
TCATGTGCCTCATAGAGGATTCGATACTTCAACTCCTCATCATGAGGGACAGCGATACGAGGGTTATCCTCAATATATGTGCGATAGCACAACAGGCCAT
TATCGATAGAATATCGATGTAGCCTAGAACGTAAACGTGCCGACAATTCTATGTCCGAGTCTTTAAACTCCTCGCTCCCAAGAGCACGTAGCAAATCTAC
ACATT