Description :
From Genome Similarity Track
Location :
contig_9:259159- 267692
Transcript NameFunction/comments
g2621.t1hypothetical protein
g2622.t1ETI32042.1 hypothetical protein F443_21065 [Phytophthora parasitica P1569

Sequence
8533 bases(100 bases per row)
GCCGTGTACTGCTTCGACGTAGGAGCCATGCGCATCTGATGGTAGCCGCTGGCGAGGTCGAGAATCGTAAACGCCACCGCTCCTACCATGCGATCGAAGA
GCTGTTCGATGTGGGGCAGCGGTATTTTGGCAACTTCCGAGGCAGCGTTCACCAGTCGATAGTCAATGACCCATCGAATCGCCATGTGCGGGTTGTTTGA
ATGCAGCCACTCCAGTCGCGATGGGAACTTGCCGGTAGACGGATCCTTCTTGGGCATCCCGAAGATGTTGGATACCCATGGAGAATCTGACACCTCGATC
CAGTTCTTCTTCAGGAGCTCTGCCACAAAGATGTCCAGCGCTTCCTGCTCGACCTTCGACAGACGAAATACTAGGATTCGCCCCTGGCTTCAAGATGACT
TCGTGCTCGATCGATCGGGTGCGGTGGTAAACCTGGTGGAAGCTCTGCTGGAAAAACATCCGAGAATTCCTCTACCACTGCTTGAAGCTGCGGCGGAACG
GTTTTCACCTTGGGGATGCCTTGACCGTGACATGATACAACTCGACGTACTCCTCAGCCTTGACCTTCGTCGCGAACTGAGCGGCTGAAATGACACACAG
CGGGGTGGCTGCTTGATTATCTCCGTCCTTGCCCGAGCCGTGAGGCGACGGCCGACAACCAAGTGACGCAATGGAGCTTGGACCCAATGGCATATGAAAG
TATCCTGCCTTGATGTGATCATTGAGCTGCTGGCGCAAGTTCGAGGGCAGTGGATGCTGAAGAAGCTCCGACGTCACCTCCACCGCAGCCACTGTTGGAG
GGGCTACGTCGAGGCTGTCGTTTATCGAGCGGGCATCCAGCACGAGACGCGGTCGTGGGAATCGCATCACACCAGTTTGACAGTTGATGATCGGGTTGAA
CTGCACTAGCCAAGGATGGCCGAGAATCACGACTTGGTTCGACGATACCTCCCACTCGATGAGGGAAACATCAGCGAATTCTCTGCCGTCAAAGCTCAGT
GTCTCGCAGCAGCGGTGTACCGTGCGGGCAGGAGTCGTAGTACCGTCGAAGCGCTCCGCAGTCACTTTGACCGCATCTACGAAGTGTTGAGCGAGGCCAG
GGCGCACGATGTTGCGTTCTGCTCCACTGTCGATCAAGACACGTACCACTTGGTCGTTCATCATCCCTTCAAAGCGCAGTAGCTCGCGTTTGGACGGAGC
TACGCTGTCAACGGACACCATGAGTTGTACGCTGTCAATGACTTCAACAAGGTTGTCGTTGTCGTCAACAAAGTCCGCTTCGTCGTCGGAGTCGTCTTGG
GCCTCGACCACGCAGCGGAACGAGCTCTGGTTCGCTCTGAACGATCTGCGTCCGTGTGGTGGCCGGGAAGGACCACGAGGGCTGTTGCGAGCCTGACGCT
TGCGGCAGTCAGTTAGACAGTGACCAGGCTCCTTGCAGTAGAGACACAGGTTTCGCCGCATACACTCTTCACGGGAGATGATGCGAGCGTTGCCGATCTT
CATTGGAGTTGGTTGCTCCTCCATGCGCTGTCTGGGTTGCGGAGACGAGCGACGTTGCGACGACTGGTGTCCTGTTCGACCAAGCTGCCGTGAAGAGACG
AAGTGGGTGCGGTCGTACATCAGCGCGAACGAGATTGCTTCCGTGGTGGTCCTGAACTGCCTCAACTTCACCTCTTGTTTGATGTCAGTCAACAGACCCT
TCTGGAAGTGCATCACCTTGTCGATGTCAGACATGTCTTCCACCTTGCAGATGAGGCCTCGGAAAGTGGCGACGTAGTCTTCGAGACACGAGAAGTTTCT
CTGGCGCAGGCGAAGCAGCTGGTCGCGCAAGTGTTCTTGGCGATCCGGCGCTGTGAACTCGCTCGTCAGAAGTTCTTCAAACTGCGTAACAGAGTGCAGG
AAGTGTCCATCGTGGAAGACGTACTCACGATACCACGCCGCAGCAGGCCCTTTCAGGTTTGCTACCAAGAGAGACAGCGGTCGCTGTTGAGGCGCTTCTG
ACCCATACTTGATGTTCTTCGACTCGAAGTAGAGCTTGGCGCTGAACATGTAGTCACCGACGTCGTCTTCTTTGGTTCCCGAAAACTTGGGCATGGTAAT
GCCCTCAGCTCGGTATTCTCGAGTGTCGACGGCAGGAGACTCACTCTGCTGCTGTTGTTGCTGCTGAGGTGGCGCCTGTTGCTGCTGCAAGGTTGCTGCC
ATCTGACGCTGGAGATCGGCCGTCTGCGCCATAAACTGTTGCTGCTGCTCGTGCATCATTGCTGCAAGAGACGCAAACAACTGCTGCATGCTGTCGCCGT
GCTGCATGGGTTGTTCGTCCATGATTGCGCCTACGCTAGCACGTCGTCACTTAGATGACTGGGGCGCGCAAGCTCCTCAGCCAAATCAATTAAAGTTGGA
GCGAAGTCACAGACACTCCCTGGAGCGCTGCTTCCGTCAAGTCAGAGGAACCCAAAAGTTGGACGAAGTCACAGACGCTCATTGGAGCGCTGCTTCCGGC
AAAGCCTGAGGAACCCAAAGCCGACGCTGTACCCTTTTCCTGGTACACCCCCGAAACCCCAGTTCTCTCTTAAACGCCCGTGGTGACGCCAACTAGGAAG
ACCGGGTGCGACCCCTGGTGAGAGCACACGCCGACTGAGTGTAGTCGACGAACAACTCGGAGCACCGGCGATGCTGATGGTAATTGGTCGCTACGGGCCA
ATTAGCGGTGGACACGAAAATGCGTGCGACAAGGCGGGTCTGCGCAGATGGATTCTCTTCCCCAGAAAAGAAAAAGCGGGCGCGCGGAAGCAGACAGAGA
ACGAGCGGGCACACGCGCGGCTGAACGGACGAAAGGGCGTACAAGCGTGTGTACGGCTTAGGCGGAGGCGTGCTGGGCGACGCGAGCTGAAGATCGACGG
AGCGACTGGAACTGGACGGACGAGCGTGCGCTGCTACCAAAGTGTAAGGGATTGAAAACTGAATTGATCTTATGTGTGTGTGTGCTATCTGTCTACCTAC
GAGCGCGCTGGGAGCGCGCTCTTGAACATGCAGTGGTTGGCTATGGTTCGCCGTGGCGCGTGCTTGCGCAACCTTCGTGAGTATGCAGATGTCGATCTCG
GCTCTCTGTGCGGACTCTCCTGGTGATGGCGTGTCGCTCTGCTTTTGTACTTGCAGATCGTTACAACCTTGCTGTGCCCATTTGCTGTCGCCCCATCCAT
CACTCCAGCCGTGCATGCCTCTGAACAGTGGTCTTACAACCACTTCACGACTTCGAGGTGGCCATTTCGCGTCATATCGAGACACTCCAGTGGCTGCTGG
AACAAGATTTCGTCATGGAAGACAGTGCTGGGGTTGAAGTGAAGGCAGCGGAAAAGGGACATACTATATATTGTCGCTCTTGCAAAACCTGCAATCTGTA
TACCAGCCCTGTCAAGGGTGTCGAATTCGCAGTTGTTAACGCAAGCCTGCTCTTTGCATGCATGACAGCAGTTTTTGAGCACTTTCACAAGCAAACGGAT
TTGGCCAGCTTGCGCATTATATCTAACGAGAAAAGGACGCTTGTCAGGCAAAGTGGTTTTCTGATATATTTTTCCCGTGCAAAGTGGTTTATATCAAAAC
TACTGTCCACCGACAAGTCGCTCAGCAGTCTGTCTTTCATGACGGCCATGGTCATGTCCGCCTGCTCGTCGAGGTACTCCTCGAGCTTGGACATGAGCTC
GACCGTCATCTTGATGCACGCAGTCCGCACGCCGCCACGCGGCTGCTGCTCGATGCTGGCCTTAGCTGTGATGCGCCGCGCAGTAGTGACAGACACAGCA
TTGCTAGCCGCAACGCCCAGCCAATCATGGCCTGCCAAAAACGCGTCGAGTACGCGCTTTTTCGCGCTGTTGCGCTCAAACTGCTTGGGGCGTGTCTGGG
CGTCGCAGACGTGGGCGGTGGGGTCATTGTTGGAGAGCGGCTTGGGGAGGCTTGGGGGGAGGAGGTGAACACGCAAATGAAGGAGTGTCTGCATGGAGAC
CATGGGCGGCTTCGCCAGTATCAAGTGGCTCACGTTGCTTCCACACCACTTTGGTTGGAAAAAATATGGCGCCAAACGCTTTGGCTGTAAAACCTTATTT
TAGGTGAATTAATAAAACCTCGATTGACCGTTTTGCTTGTGAAAGTGCTCAACTTGCCTGGTAAAAGGTGTAAATTGTAGCCTCTAATTTGCAGTAGAAG
CCGAGATATCGGCAACGATCCGCTCCGAAATTGGGGGTCCTATCGATTCGGCGCACGGTACACGGGGCTCTGCTAAAACGGTTGTTGAAGTCCCCACGCC
GCACCGGTTTTGACGCTGGGTCCTCGTGGCATGGGGAGGAGGTATCGTGCAAAACCGTGGTGACCTGTGCACAACTGGGATGTATCATTTGTACCCAAGA
CACAGGTGGTGTGGAGTTTGCAGGTTGTCTGTGGTCATTCAGCATTTGCCATTGCAACGATGACATCTCCTCCACCTCCACCTCCTACTCCGCTGGTTGC
TGCGTCGATTCTCACCGGTTCCAAGCGCGAGTTGTCATCGTTGTTCCACATCACTGAAAAGGTTTCTTCCTTCCTGGACACATCGGTGGAGCTTCCACTG
CATAAAGCCTGCACGTTCGGCTCTCTGAAGCTATTGAACCGCATCTGGAACAGTACAATCGACCTGGAGCACGAAATCGAGCCATTCTGGTCTGTTCGAA
GCTTTCTCCGCTCGGACAAGCACTACCAAGATTTCCAGTTCACGGCTTCGTTAGTCGAGGCAGTGAAGCAGAGGAATCTCGAGATGGTGCAGTGGCTCTT
TGAACATTTTCCCGAATGGGGTGTGGGTCGGGAAGTAGTTGAGGCGGCGGCAGAAGTTGGAGCTCTGAGTATCCTGCAGTTCTTCGGCCAAAACGGCAGG
AACCTCAATCCTCATGATGACGACGAAGAGGATGAGGATGAAAACAACAGAGAGCAGCGAGGCATCGACTGGGGCTACGAGGATGCGACCAAAGCGGCCG
TGGCTGGTCATAGAGACGTCGTTATGTGGTTTTATCAATACGCTGGAAGCTACACGAGAGATGATCAGAAGACAACATTGGCTGTTATTGCCAGTGGAGA
TGTGGATTTGATCCAATGGCTCTGGGAACGGCTCGACATGCCGCCTGGTAAAGGAATGCGTGAAGCAGCAGCGAACGGGCACATTGAAATGCTGGAGCTG
TTGGAATTTCAGGGTTACGGCGGCATTGACGTTGGGCAGCTCGTGAAAACTGCTGAGGCTGGCCAATTGAATGCTGTTCGATGGACTATCCGAGATTTGG
ATAGACAAGATCGCAATTACCGTGATTGGGGGGACTACGGATTCGCTCTGAGATCCGATTCAAATAGGGGACGCGTTGAAATTACCCGCCTCGGTTGGGA
AGCGGGGCTTGCCATTCACGCTGCTGCAGTGAATGGACACCTGGACGTTGCGAAGTACCTCTACGATCGCATCGACATTCGACTTGATTTTGACGACAAA
GTGCAAGGCGGCAGAGGTCCGAACACATGGATGAAGGTGTTGAAAAAATTGGAACTTAGATCTGAAACCAATTTATCAACAGTCTCAAGAGATACGATGG
TGCTTGTTGCGGAGCGAGGCTTTCTCGATGTTGTCCAGTGGCTATGGGCAGAATTTGGCGATGACTCAACGATGAATCTCTTGTCTGCGTGCACAAACGA
GCAATCGAGGTACGATTGTGCACTGGACGCAACTGCTGCTACTGGGCACTTGGCGATTGTTCAGTACCTGCATCAAATTGGCCAAGATCCAGTCCTCGAA
GACACCCGCAACCTGAAACGCAGATGGCTGCTCAAGTTCCCAGAACTGTGCTGCCATAGAGATCCAGGTTACAGCTCTGTACAGCCATTGGGGCCTTCCC
CACCAGGGACGCTAACCTGCACGGTGGCAGCAATGGATCTCGCTGCAGCCCATGGCCACCTAGACGTCGTTCGGTGGCTTCACCATAACCGGACGGAGGG
CTGTACTACAGACGCCATGGACTACGCTGGACGAAATGGTCACTTGAACGTGGTGCAGTGGCTCCACCAACATCGCGGAGAAGGATGCACTCCGAAGGCA
ATGGACGGAGCGGCGACTAACGGCCATCTGGATCTAGTGAAATGGTTGCACGGTCACAGAACGGAAGGATGTACTGCGGAGGCAATGGATGGAGCAGCTA
GCAATGGGCATCTTGATGTCGTACAGTGGCTCCACTGCAACAAGTCTGAAGGTTGTACGACTGCTGCAATGGACGGCGCCGCTGCTTGCGGGGCACTTGA
TGTTGTAAGGTGGCTGCATCATACCCGCAGTGAGGGCTGCACGACAGCAGCGATGGACGGCGCTGCTGGGAACGGCCATCTTCGCGTTGTTCGGTGGTTG
TATGATCATCGCGACGAATGGTACTCAGTAGCAGGAATGGACCAGGCACTTCAAAGGTCCGAGTTTGAATGCTTGGCACTACTGGACAAGATAAAGCGAG
GAAGCTTCACCGCCTTGCGAGGTGTGGCGGACTCAGGCGTTCGTAGATGGCTTCTTGAGCGGTACCCCGAATACAGGTCTTGGTATTATTGATAAGCTGG
CCAAGAGTTCAGATGGCTGCACGACCAGCGAAAGTTGTACGACAAGTGATGAGCAATGTCATCTTGAATTTCAAATTCGACTTTGCTCTCCCTAAAACGG
TTGGATCTTTGAGCGTAGTCAACATTGAGCAAATGCAACCATCGACTATTATTAAGATTGAAATCGAGCTGCCTTTGATCAATGAGAACCGTTCCGAAGG
CTGGACACCCAGCGCAGTAGGAAACGCTGCAGGCATTTCGAGATCGTGTTGCTATTGTACAAAATAAGAGACGAAGGCTGCGCGATCGAGCTGGGAACAG
ATGAACTTCGGATGTCTGAGATCCCCAAGTGGTTGATGAGTCACTATCATAGTGCCGTACGAGCTATCGTTTTCATGAAACAATTGCACAAAGACTTCCT
CTACGAATGCATTTGAAATATGTATGGATTCGATTGGTGTGCGACACACACATTTGCCAACAATCAATCCTGCCAGAAAAAGTCGAGATGAACTCGTAGA
CCAGGGCTGCTCATTGTCGTGAAGCTGCTGTTCCGCGCCAAGGGCGAGTTCTTGAACCTTCCCCACGTTGTGGCTGCAGTCTCTACGTTCCTGGACTCTG
CGATGGAACTTCCTCTGAACGAGGCGTGCAAGCGGAATTCAATCCAGCTGCTGAGTCGGATTTGGGCCAGCAGCGAGATTTTCACCGTTCGCAACGAGAA
TATGGCGCAACTCTCCTGGACGTTACGGAGACTTGTTCGCACGGATAAATACTACCGACAGTATCAGTTCTCACTGTCGCTGGAGGAAGCTATTCGCCTA
CACAATCTAGAGATGGTCAAGTGGCTCGCTTCTAGGTTCCAAGGCTGCATGGTGCGTGAAATACTGTGAGTCAAGCAGTTGCAACGGGGTCCATCCCGTT
GCTGAAGTCTTTGCTTGAAAGTGGCAATAGTTCAGTGAATCCAAGTGTTCAAGCTACAGACGTGGGTATTCGTGTTCAGTGGAGCGAGAAAAATCTCTCT
GACGCAGCGTCAAGTCGGCGTAGTGACGTCGTGTGGTGGTTGCTTGAGCACTTTTCAGATGAAAGTCACGACAAAGACAGATCTCTGCAGATTGCAGTGA
ATAATGGTGCCGTGCCATTGGCTGATTGGTTACTCCAGCAAGGTGCAAGATGGCCGAGAAATACACAAGGCCTGCAATTGGCGCACTCTGCGGCAGCTCA
AGGACGTATCGATGTGCTCAAATGGCTGGCGAAGCAAGGTCACGTGGAGGGGCTTATTGGACTGGTGGTGATAGCTGCAGATAAAGGAGAACTCGATGTT
GTCCAATGAGTGATCAATCGCGATACACGAAAGAGTGGCGGTACATATCTCACTGACTAGGGTGGGGAAATTAGCCTCTTCATTCATAGTGCTGCAGTGG
CAGGCCATTAGAAGTTGCAAAGTATCTTCGAGCACGCACGAAAAGCCGACGGACAGCTTACAGCGCGCAGTGGAGCAGGCAAAACAACGTCGGAGCCTCC
AAAAATTGTCTATGTACCTCAGTTACTACGATAATTCTGGAATATTACCAGGGAAAACGATGGCGGATGCAGCGGAGAAGGGTCGTCTCGACGTGGTTCA
ATGGTTGTACGCAGACTACGGCGAAGATCTTCATACTGACTTGTTTGGCTATGGTGAAGCGAACATGTGAGATATTTCGATCGCGATGGATGCGGCTGCA
AGCAGTGGACATCTTGATGTGATGAAATATCCGAATCAACTACATATTTTGATTTAAACGAAGGGTAAATGAAATGATTGCGAAAAGGGATCCAGTCCAA
AAAGCACGACGGCAGCAATGCATCTGATAGCTGAGCATGGTTACCTGCAAGTTGTAAAGTGGCATTTCCTTACAACAGAACGGAAGGCTGTACAACGAGT
CCAGTGGATGCTGCGACAAGACGTGGTAAGTTA