Description :
From Genome Similarity Track
Location :
Scaffold_157:25915- 32667
Transcript NameFunction/comments
g10582.t1ETK78359.1 hypothetical protein L915_15595, partial [Phytophthora parasitica

Sequence
6752 bases(100 bases per row)
GCAGGGATGGCCATGACGCCCGGTGGCAAGATGGACCGCCGCCGCGCCGGCTCCAACTACTTCCAGCTCGACGCGGACCGCAAGCGCAACACGTCGGCCA
ACCGGTCGCACCTGAACGGGGACGGGCGCGGCACGTTCGGCGACCGGCTCAGCATGATGGACGTGCTGCCGCCCACGACGCACGGGGGCAACCAGCTGCG
CGGCGGCGGCCTCGAGGGCGACTTCGCGGACGAAGTGTCGGTGGACTTCTGCTGCGAGGTGCTGTACAACAAGTTCGGCTTCCAGTCGGGCTCGGTAGAC
AACCAGCGCGAGCACGTGCTGCTGCTACTGGCCAACGCCAAGGCGCGCTCCAAGCCGCAGGACCCGCCGGGCCACCACGTCGTGACGCTGCACAAGAAGC
TCATGAGCAACTACACCGAGTGGTGCCAGTTCATCGGCGCGGGGAGCGTCACGTACACGGGACAGGCCCAAGGAGACCTCAAGAACCCGCTGCATATGGA
CATTATGCTCTTCCTTCTGCTATGGGGGGAGGCTGCCAATCTGCGGCACATGCCCGAGTCTCTCTGCTACCTGTACCACCAGGCGGTCAATATGCTCAAC
CAGGACTTCCTCGGACAGCAAAAAGTACCCGAAGGATGGTACCTCAGACAGGTGGTGCGTCCTATTTGGAAGGAGGCCAGCAACATGCAGCGGAAGAACA
GCTTGGGCAAGAACTTGGAGCATACGCAGGTGCGCAACTACGACGACATCAACGAGTACTTTTGGAAAAAGTACTGTTTGAATGTGGATATCACCCACAT
TGGCGAGGAACTGACCAAGAAGCACACCAAGACGTACTACGAGCACCGTAGTATTTTCACGCTCGTGCTCAACTACTACCGCATTTTCCAGTTCAACATG
ATGTTCATGATGGTGCTCATGGCTATTGGCTTCATCTCGGCCATCTCGCCCAGTGGCGGCCAGCAGTGGTTTGCCCAGTTTGGCTCCATGGGCGAGGTGG
TGGAGCCCTACCAGCAGCAGGACGTCAAGCTCACGTACGTGGGGATTGTGTGCGCGCTCTCCACCATGGGGTTCTGCAAGACCGTCTTAGAGGCGTGTCA
CGGATGGCATTTGCTCACAGCCAGCGAGGCTTCCGCTACGTCGTCACGGTCGTTCAACTACGGAAGTGCACTGGTTGTTCGTATGCTCTGGAACGGAGCG
TTCGCTGGCATCTTCGGGTTGATGATTTACACTCCACTCATCACGAGCAAGAACACTGAGCTGTTGGACAAGGCTGCTCCAGCGTCAATTGCCTACATTA
TGCCTGGCGCCTTGATCATGACTGTCCAGGCTTTTGCCCCGTCGATGGTCACCAAGACGTTCGCGGCCAAGTTCATCCGTGAAGGTGAGTCGTGCTTCGT
GGGACGCAACATGGCGCCTCCGCTCAGCTACCAGATCAAGTACATCACGTTCTGGGTGATTCTGTGGGCGCTCAAGGCGTTCGTCTCGTACTTCATCCTG
GTGCGTCCGCTGGTCTTGCCGTCGCTTGCCATCTACGAGATGGATCTCGAGTACGGTAGCAACGTTGTGTCGTTCCACAACTTCGGCGTGATCCTGGCGC
TGTGGATGCCGGTGGTGTTCATCTTCAACTACGATACCCAGATCTACTTCACGATCTTCCAGGCTACTCTCGGTGGTATCCAGGGCCTTATCATGAAGAC
AGGTGAAATTCACGGCATCAAGGAGATCACGAAGGCCTTCCGCGTCGCGCCTCAGCTTTTCGACCAGAAGGTGGTGACCAACCTCGCTCGCTCGAACGAT
GCTGCCGCCGATGGCTCTGCTGCCGCGTACCAGTCGCAGATGATGCTGCGCTTCGTGGTCGTGTGGAACGAGATCGTGAACTCGTTCCGCGAGGGAGACC
TGGTGGACGATAAGGAAGCTGCCATCCTGCAGTACGACATTCAGAGCTCCGGCGATGTGTTCGAGCCTGTATTCCTGTCTGCTGGAAAACTGGTGGAGGC
CCTCGACTACACAGTCAAGCTGGCTAAGGAGGGCAAGGGTGACTCGCAGCTTCAGGTGTACATGGTGCAGAAGGATTGCCTGTCTGCGGTGCGCAGCTTC
TTCACGGCCAGCATGTACGTGATGGAGGCTTTGCTCGGCAGCGACGATGCGGACATCCTCGACGCGCTTCGCCAAATGGAGGCGATTGCTGCCAACGGTA
GCTTCATGAGCACGTTCGATGCCAAGAGCCTTGTGCAACTGCGCACTGTGTCCATGGAGTTCTTGGAGGCCGTGATGGATCTGCCTGACCCGGATGCTCA
GTCCTCGCACTTGACGACATCCAGGGTGCACACAATGGGTGTCGTGCGTAACTTCGTGACGAAGATGGAGAACTTGCTCAACGCCATCCGCATTCTAGCC
AACCGCCCTGAACTTGCTGCCAAGTTCAGCAACTCCAAGTTCTGCTCGAGCGCGAACGGCTACGTGTTTGCTGCCCGTGGTCTGGTGAACCTGTTCCACA
ACGACACGGCCATGGGTGCTGCTACCCGCGCGTACCTGCTGATGTCACTTGAGAAGGCTGATGCGATGCCGCGCGTCCCTGAGGCTCAGCGTCGTCTTGG
TTTCTTCATGAAGTCGCTTCTGATGGACATCCCGCAGCTGACTTCGGTGAAGGAGATGCATTCGTTCTCTGTCGTGACCCCATACTACAGTGAAAGTGTG
CTGATCTCGCTGTCGGAGCTGAACGATCCGCTAGTGAACCACCCAGTCTTCAAGAAGGTCGAAGAGAAGGGCAAGAACATTACGATTCTCAAGTACCTTA
TTACGATTCACCCGGAGGAGTGGGAGAACTTCTTGGAGCGTATTGATGTGGGCTCGGCTGAAGAAGCGCAGGCAAACTACCCGCTGGAGATTCGTCTCTG
GGCTTCGTACCGTGGTCAGACGCTGGCGCGTACCGTCCAGGGCATGATGCTGTACGAAGATGCCATCAAGATTCTGCACTGGCTGGAGATTGGCTCGAGC
CCCGGCAAGACGGCCGAGCAGAAGCAGGCTCAACTGGAGGACATGGTGCGCCTGAAATTCTCGTACATCTGTGCCTGTCAAGTGTACGGTAAACACCGTG
CTGACAACAAACCTCAGGCCGATGACATTGACTATCTTCTGAAGACGTACCCGAACCTGCGTGTGGCGTACGTCGACACCATTGCGTCTGACGGAGGCAA
GCAGTTCGACAGTGTGTTGATCAAGAGCGAGGGCAACGAAATTGCTGAGGTGTACCGTTACGAGCTGCCCGGCGATCCGATTCTTGGTGAGGGTAAGCCC
GAGAACCAGAACAATGCGCTTCCGTTCACACGTGGCGAGTACCTGCAGACAATTGATATGAACCAGCAGCATTACTTTGAGGAGTGTCTGAAGATGCCGC
AGCTTCTGGTGACCGCTGACCTGCACCCTTCGAAGAAACCTGTGTCGATTATTGGTATGCGTGAGCACATTTTCACGGGTAACGCTTCGTCGCTGTCGAA
GTTCAAGTCGTGGCAGGAGCTGGTGTTCGTGACGCTGTCGCAGCGTGTGCTGGCCGACCCGCTGTACGTCCGTATGCACTACGGTCACCCTGATATTTTC
GACAAGATTATCGCCATGCCTCGTGGTGGCGTGTCCAAGGCTAGTAAGGGTATCAACTTGTCCGAGGATGTGTTCGCCGGATTCAATGCCACGCTTCGAG
GTGGTGTGGTGACCCACGTGGAGTTCATGCAGTGTGGCAAGGGTCGTGATGTGGCGCTCTCTCAGATTTCGATGTTCGAGGGTAAGCTGGCTAACGGTGC
CGGTGAAACTGCGCTGGCGCGCGAGGCTCACCGTATGGGCCAGTTCATGGATTTCTTCCGTCTGAACTCGATGTACTACTCGCACACGGGTTTCTACTTC
GCAACGTGGATGACGATTGTGACGACCTTCGTGTACATGTACTGCAAAGTGTACCTGGCTCTGGCTGGTGTGCAGCAGCAGATTGTGTACGACATGAACA
CAACTTCCGTGATTACCGAGAACATTGCCAACAACTTCGACGAACGTGTGTTCACGGACCTGAAGGCTGTGTTGAACACTCAGTTCTACATCCAAGCCGG
TACCTTCTTGATGCTTCCGCTGATGTGCGTGTACTTCGGTGAAGGTGGTCTGGTCCGTGGTATGACGCGCTTCATCGACATGATTATCACGCTCGGCCCT
GCGTTCTTCGTGTTCCAAGTCGGTACGACGATGCACTACTTCGACAACAACATCGTTCACGGTGGTGCCAAGTACCAGGCCACGGGTCGTGGTTTCAAGA
TCTCTCGTGAAACACTGGTGTTGCTGTACAAGGCGTACGCAAGCTCACATTACCGAAAAGCTTGGGAGCTTATTGGCTTGTGTCTCGTGTACTTGACGTT
TGGTAACTTCTACATCTGTCAGACGGATGCCTCGGCCAACGACAACACCTTCGCGTCCGACTACTGTGATACTTCCCAGGCTTACGGTGTGCAGACGTTC
TCGGTGTGGTTCATTTCCATTCTGTGGGTTGTCGGTCCATTCCTGTTCAACAGTGATGGTCTTGACTACAGGAAAACGAAGGTGGATATCCAGCAGTGGT
GTATGTGGATGTTCGCTCCCGAAGACTTCCAGGACGACGATCCGGCAAACAAGGGTGGCTGGGTAGGCTGGTGGAAGGGCGACCTGGAGCAGCTGCACGC
CTCGAACATGATTTCTCGTGTCACCGTCATCCTCCGAGAGTGCCGGCACTTCCTGCTGATGTTCTACGTGGCTACACTCGAGACGTCTGACGTGATGTAT
GTCGCCTACTCATTCGGTGCTGCCGTTGCGACTGTCGTTCTGCTGGGTGTTTTCCATGGCATCGGTGTGGGCATGCGCTCCATGAGCCCTGTAACTCGCG
CGATGATTTACTTAGGTACCATGACCATCTGGGTCACGGCGTACTTCTTGGCCACTAAGATTGTCTTGGACTGGAGCTTCACGTACGCAATTTCGTTGTT
CTTCGCCTACGTGGCTGCCTTGTACGGCATCAACGAGTGCTTCCGCATGTGGAGCTTCCCAGGCTCCTCGATCGCCAGCATCCCGATGTTCCAGCAGCTG
CAGTTCCTGTTCGACTTTATCTTCTGCACGGGTATGATCATCCCGCTGGTGATCTTGTCCTGCATCCCGTTCTTGAACGTTATTCAGACGCGTATGATGT
ACAACGAAGGCTTCTCGAAGGTCATGTCGGCATCGTCGCAGTACGCGTTCTCGCTGGCCGCCTTCATGGGCATTCTGGGTGGTATTGGTGTTGGCTGGCT
GTTCAACCTGCTCTCGACGCTGGAGCAGTCGGCAAGTTTTGCGAGTTATGTGGTGACGTACGACGGCGTGCTCAGTGGCAATGTTGGCGACGGCACGACC
ACCTTCATGCTGTACGGCGCCTGCGTTGTCGGCACGATTATTGCTGGCTTCTTGAACTACTTCCTCGGCCGCCGCTTGTCCATCGTTGCCGGTGGTCTGT
TCAGCACGCTCGGTATGGTGGCTGTCAGTGCCAACGACGACCTTCGTTCAACTCTGCTCATGCCTGGCATTGGTCTGCTCGGCGCGTCTTGCGGTATCCT
GCTGCCGTCACTGGCCATCTACATCTACGAGATCTCGACCAAGGAGATGCGTGGCAAGGCTATCTTGCTGCTGGGCATCGGCTTCATTGCCGGTAGTCTG
CTTGGTGGCATTTTCGCGACTGTGAACCAGTTGGGATGGATCTGGCAGACGTTCGCTGCCTGCATCGTCATTGCGTTGGTCACTCCGGTGGTGAACGTGT
TCCCCGAGAGTCCGTACTGGGTGCTGGACCGCAAGGGCTGGGACGCGTGCGAGGCCTGCCTGGTCATTCTGCGTCGTAAGCCTGACGTGCACGACGAGCT
CAAGATCATGCGCGAGGAAGAGACCGCTGACGAAGGTGGCTCGGGGCCGTTCAAGTTCCTGATCGGCCTGTTCCTCATGCTGGTTTCGGCGCTCACGACG
GGCTTCTTGAACGCCTTCATCAGCTACAAGGGTGCCAGCGAGTACACCGACCAGGACCAGTTGTTCGTGAACGGCATGGCGCTGCAGATCTCCGGCGCGG
TCATTTCCTTCTTCTTCATCGACAAGCTGGACCACAAGTCGATCCTGTTCGCAACGCTGATCCCCGTGGCAGGCTGCGCGGGCTTGCTTGGCTTCAACGA
GTCGTCGGATCTCCTCGGCAACCCGGAGGGCTCGGGCCTGTACGTCAGCCTGGTTGTCATGCTCATGTACTTCTTCATGGGTCTGGGTACGAGCTCGCCC
CCTTGGACGGCGTGCGTCGGCATGTTCACGACGCGAGGTCGCGCCTCGTCGACAACGTTCCTGTTCGCGATGTTCTACTTGCCCAACCTGGGATACGTGT
ACATGCACACGCACGACTCGATGATGGCGAACGAGTACTTGTACCTGTACGCGATCGCCGGTCTCTGCGTCGTTGTACTCGTCCTGCTGCTGGGTGCTGG
TACCAAGAAGAACGGCGTCATCTCGACCAAGGCTGAAGGCGAGCGTGACCGCGAGCGTGCTGCTCGTATGCGGGCCGATCGCGCGACTCGCGCTTCTCGT
ACGCCAGGTGCGCGCCAGCGGAACCTCAGCCGCGTGCGGTCCAAATCCAACGCTGGCGGCCAGCGCGGCAACGCGACGCCCGGTGCCGGCTACCAAATGT
ACGAAACACCCGCGCACGCTGCGCCGCCGCTCACGCACGCACGCGCATAAAG