Description :
From Genome Similarity Track
Location :
Scaffold_370:25909- 27321
Transcript NameFunction/comments
g12099.t1hypothetical protein

Sequence
1412 bases(100 bases per row)
CCAACGACTCTCGCAGTCGTTGGCGTTCGCTTCGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTGATGGAGGGCCGCATGCACCGCGTGGTGCAT
GTGCTGTGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGA
CTTGCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACAAACTCCTTCTCTTGATAAGAGAAGCGTACGCGT
ACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGTCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGC
TCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTT
GTCATCTTGTTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGC
GCGGGGCGCCCTGCTGGTCCCTCTAGTTTTTTTTATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCTTCGCCGCGTGCACAGGTGCTGTGCACT
CGCGAGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGGACCAGCAGCGGTCGCACTCGAGAGGTCCAT
TGGTTCGGGACCTCCCGACGGCCTTTTCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATT
GCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACCCTCGGAAGAGATAGATCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTG
TCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAA
CTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAATGCTAGTTTGAGCTCCTCCTTGAAATCCTCGTACGTGCTAAAGCACGTAGGGTCTGTGAGT
CGGCGTCCGTACGCCCAACTCCTTTCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAG
TGTCGACCTCGACAAGCCAACGGAGGAGAGGCTCCCCCTCTCTTCCAACGTAGCTGCTTATGTAATGGGTCTGCTTAGACCCACCACTTAAGCTTACACG
TGTGCGCACGTG