Description :
From Genome Similarity Track
Location :
Scaffold_361:25906- 28023
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_361-snap-gene-0.13Dynein heavy chain
Pytve_DAOMBR484maker-pve_contig_361-fgenesh-gene-0.7DUF1168 domain protein

Sequence
2117 bases(100 bases per row)
CCGACGCACCAACAACACGTACCTGAGCGTGCTCATCAACCCAGGGCTGCTGTCGGGGATGGAGCTCGGACCGGGGTTCAAGTCGCCTAATCCGGACGAG
TTCGCGTTCGCCGACTACGCCAACTACATCGAGAAGCACATGGTGCCGGAGGCGCCGCCGCTGTTCGGGCTGCATCCGAACGCCGAGATCGGGTACCTCA
CGACCACGTGCGAGACGCTGTGCTACACGATCGTGACGATCGGTGGCGGAGGCGGTGGAGGTGGCGGCGGAGATGGCGGCGGCGGAGGCGGACAGGACAA
GACCGCGGTGCTGCGATCAGCCATCGACGACTTTGAGACGCGCTGCCCGGAGTTCTTCAACATGCTGGACGTGGCCGAGAACGCGACGCCGCACCTGACG
GAGGAGCACGGACCGTTCGTGGTCGTGGCCATGCAGGAATGCAGCCGCATGAACGTGCTGCTCGAGGAGATCCGCACGTCGCTGTCGGACCTCAAGAAGG
GTCTGAACGGCCAGCTTAATATGTCCCAGGCGATGGAGGACCTTGCGACGGCCATGGCGCTGAACGAGGTTCCCGGACGCAACCCGTTCTCGCAGTGCAA
GTGGGAGAAGAAGGCGTGGCCGTCCAAGAAGTCACTCTCGGGGTGGTTCTCCGACATGATCAAGCGCCACGCGCAGCTCGCTTTGTGGGCCACCGACTTC
GTCACGCCGCTCTCCATCTGGCTGCCTGGCCTGTTCAACCCGACAGCGTACACGACCGCGTGTCTCCAGGTCACATCGCGCCGCAAGCTCATGCCGCTCA
ACCAGATGACGGTCGAGACGCACGTAACGACGTTCCAGGACCCGAGCCAGGTCACGTACTACCCGGACGACGGCGTGTTCGTGCACGGACTCATCCTCGA
AGGCGCGCGCTGGTCGACAGCCGACGAAGTGACGGAGCGCGTCAAGATTGGCACGTCGCCCACGACCGAGTGCGGCGGCACGCTGCTGGACAGCAACCCG
AAGGAGCTGTTGTGGACTATGCCGGTCATGTACGTCAAGGCCGTGCAGACGCAGCCGCAGTGGGAGCCGTCGTCCGTCGGGTACCTGCGCCACGACCCGC
AGGTGTACGAGTGTCCCGTGTACCTCACGCGCTTCCGCGGCCACACGTACATCTTCCTCGCGACGCTGCCGACGGACTGCGGCCGCGAGAAGTGGGTGCT
CCGCGGCGTCGCCATCATCTTCCAGGACGACAACTAGCGGCTGGTCTCCTCGTCCCACGACCCCTTGATTGTTTCGACCCGGAGTCTGTGTTTCGATCCC
TTTATCCATCCGTGCACTGCATCATATTTTCACCTCATGCCTGTATTGTCGTCTGGGTGATCTGTGCTATTCCTTTTGCTCGCCTGCTGCCTCCTTGGCC
TTCTGCTGCGCCAGCATGTGCTCGAGGAAGCTGCCGTCGTTCGGGATCTCCGCCACGCCACCCGGCGTCGGCAGCACGGCCGGCTCCGTCTCGTGCTTCT
CCGTCTCTTTTCCGTCCGCACCAGCTTGCTCGTCCTCGTTCGCGGCGGCGTCCAGCGCGCGAGCCTTCTGCCGCTCCTTGCGACGCTTGCGCTTGTCCGA
ACGCTTGTGCGCTCGCGCCTCAAACTCGTCCGCGTTGCGCTTGCGCTTGGTGGTGAACTCGTCCTGCTGCTGCTTGGCGACAAACTGCTTCTCCATCGTC
GCGATCCGCTCCATCTCCCTGCACAGACACCAACCGCTCCGTGAGCCGCGAGTCCCATAGCAGCACACCCTCCATATCAAAATAATAACAGTAAGACAAA
CCTCCGCCGCGCGGCGCGGTACATGTGGAACTCGCCGCTGCCGGCGCCCGCCGAGCTGCCGGCCACATTGTCGACGCGGTTGATGTGGAAGCGGTCGCTC
TTCGGGTCGTCGGCTGGCGCGGCAGGAGCCTCCGCCTGGGTCGGAGAAGCGGCCGCTGCATTGGCAGAGCTGTCGGCGCCAGCGGTCGTCGCTGACGAGT
ATGAGATGGCCGCCACCTTGGCGTCCTGGTCCGTGTAGGTCTGCACGGTCGTGTAGCGGCCCATGGTGCTGGCTAGTGTTGAGTTTCGAGGAGTTAGAAA
CTGTGTAATTCGTTACA