Description :
From Genome Similarity Track
Location :
Scaffold_513:259- 6248
Transcript NameFunction/comments
Phyag_g6295hypothetical protein PHYSODRAFT_552991
Phyag_g6296conserved hypothetical protein

Sequence
5989 bases(100 bases per row)
AGATGCCCGCCGACATTGAGCGCATCGTGGACCGCAAGCTCAtcaagcagcgcgtgcacTACTTTGTGGTGTGGAAGGGCTTCGGGGAGGAAAACAACAC
CTGGTACGGACGACAAGCTCCAATAAAATACCTATGAAAACTACCAACACTAACATGTTAATATTATTATTATTAATAATAATACAGGGAGAGTCGTATC
GACTTGATGGCCGATGGCTACTCGGACGTCATCAAGCGCTTCGAAGAACGTACGTATCTCTTCGTTCTTGATACAATAATGTTCATTGACTAACGATTAT
TATTAATTTTTTTAATCTACTGCAGAACGCAAGAAGGAGTCGGGAGGTTCGAAGCCTCGCGGTCGCAGTCCTGGCCGCTCGAGGTCCAAGAGTCCAGGCA
GAAGCAAGAGTCCTGGACGTGGTCCTGGGCGTCCGAGGGgacgtcgcagtcgctcaCGTAGCGCCTCGGTGAGCAGGAAATTGCCTGTTAGCAacaacga
ggaggaggacaagaaggagaagaaagaaaagaaggagaggaagagcagcaaggagcaggagatcACCAGTCCCCCTACTCGCTCAGCCACGACCCAGCGG
CGACGCAAGAGTCCCGGCAACAATCATGAGAGCAAGAACGAGGCCAATGGTGTAGCGAAGGAGACGCCCAGACGCCGATCGACCCGGAAACaggtgacga
tggagacgtcgacgacgcagttTGTGTCTCgtctggacgaggagaaggcgaaCCCGACCAcggatgaggaggacgacTCGCTTCTGCTCCGATCAACCAT
AGCAGCGCTGGCCCCGCAGGTGTGCGAGATGGCCCCTGCTGCCCCGTTGGCGGCGGAAAAGGATATACACAAGAAGCCGGTGACCCTGTCAtatgaggaa
gaggaggatgaagTGTTGTTGAAGACACCGAGCACTAAGGAGACTGCGCGTGCAACGGTTAGTCCCGATCACGAGCATGCTAGCCCCGTGCAAGACAGCT
TGATTgccaaggtggtggagagtGGCTACCTTGCGTCGTTCCTGAGTGTAGCGGCGGTCGTAGGATCTCTCGTTGCGAGCCAGATTCTGCCTCGTGATGC
TGAGGAGGGCACCGACCTGTGGCGGAGGTGGCTATCATTCCTCACACCTGttgtggcgttgctgctcttcttccaccagaAGGATGGCCGTGCTTCGGCA
AAGTGGGTGGCCACTGGTTTGGCCtggcgtgctgctgcggagctgttgctgctgatcggTGGCACGCCCCGTGAGTTCGAAACGATGATTGCTGGTTCGG
TTGTTCTTGCTAACGGGTCGCTGCTCATCGCGCTTACGGCCATTCTTCGCAACGGCGAGCACGAGCAGTCCAAGGCTACGCTTGCTCTCCTGATGGCGGG
CGTTTTGACGCTTTTCCTTTCGGACAGGTAAGCGCTTTTCTGTAAATTGGGAATGTCTGTATGCTGTGTGCTGATGTTGCCATGTTGCTATTGTTTTTCA
GCTGGGCGATCTCGACTGAGAATCCGGAGCTGGAGTCGCGCGTTATCCTCATGTCAATGGCCGCTGTACGTGCTTCATCCTAGCTGTCGAAGTGATGATT
TGTACGACTGACTGTTTTGTGCATTTGTTCAAATGCTCAGCTGACGATCGCACTGTCGCCCATGCCAACTGTATCctcggacgatgatgaaTAGGATAGG
GCGCATCAGGCCCGCTCGACACTGTAATTAGGAGTTCTTGTTTTTTTCGCTGACCTCATTCGGACTCAgcgctggcgctgttgtATGAATTTTATGATTT
CCGCTGATGCCGGCATGGCTATGTTAGACTTTATTCATCCATCGTCCCAGCAAGGCAATCGCGTGTCGTAAAATTCTGTCTGTATTATCTACCGATCCCG
ATGCCTGTGTCCAGCCATTTACTGTAGCGCCAAATGCAACGTCTTGATCAGCAACTGCTGACTTTGGACGCTCACGACTGAGTCAGCATCACCCTCGCTG
TGCACAAGCTCTCGAATAACCTCAATTGTCAGTGCTGCAGTAGTGTGAGCACCACGCACGCGGTTCTCGGGATTCGATGCATACTCCTTCATAACCTTGT
ACAGTAGCGTTTGACGCATGAGCCACTCCAGCTTCTCTTCATTCACACCCGCAGCCGACTCGGCCGCCAGGTTGTCCCATAATTCACCGTCATCAACGAT
GCAGGATCGCCACACACCCGCACGCATCTCTTCGTACTCTTCGGTCAGCGGGTCAGTTGCGAGCGTCTCTAACGCCTCAAGCGCCATCAGGAAAATGTTG
GTTCTGTTTCATATAACGAGTGAAGATGAGAACGGCGACAAGAGCAACTATAATACACACACAGCGCAGGCGTTACCGCATGGGGTCATCTTTCTCGAAG
GAAAGGGCTGATGTCAAGCACGCATGAACCAGCTCTTCAGGTGACAGCGGCTGCCGAGTGACCGGGTCCTTCAATGACAACTGCAGTAACAGCTCCTGGA
TCTTTCCGCGGACAAGCTACGCAACACATAACAAAACTAGTGAACAACCCCGCTCCAGCTACGATAGTAAGAACAGCAAAACATACCTCATGGTTGATGT
CGTGAACCCTCTCAGGATGAGTGAGACTGAGCGAAGCAAAGGCAGCGATCTTAGCAatgctcgccatcgtcttgcgCTTTAGCAAAGATCGCTGCTCACC
CTTGGCTTCACGCAGTGCAAGTGTCGCCACCTGATCGTATCGCTCGATTGAGACTGCTGTCAGCCAGCGGAACTTCCTCAGGTGATCACGGCTTTTCATG
AACTTGTGTAGTGATGGCGCAAAAATCTGCGAGTGGGCCAGGAGGTATGCTACCATTGTCGCGTTAGAGTCTTGGTCGCCTTGCACCCATGGGTTCCGAA
CCTCACCGTTATACCAGCGGAAAATGAAGTTATCGAAGCCctcgtgcttcttgcagTACGCCTCCAGCCTCTTTGACGCGGGGCTCTTTGGCAATTTGCC
CAGGACACAATCCAGCTTGGACAGGTTCTCAGAGTCTTCAACGAAAACAAGGTACACCACGCCTTCGAAGTACGAGTACTTTTCACAAAGTTCTACGCAT
TGGCTGAACAGCTCTGCTCGCTTCCGCGTGGCAAAGCCATCCTGTTCAAAGTCAACTGCGATGGCACTTTCTTGTGACAGTGTCTGCGTCGCGATGTGGA
CTAGAGGGTTCAGCGTCACGCGTTTCGTAAAAgtttcctccttctgcaactcatctgcttcttggcttgAAGCAAGCGGGATGAACCGAGCGTAGTCGTC
CAGTAAAACGGTTCCTAGTCTTTGAATTTGATCCGTGAGCTCGAACACTTCTTCGTACTGCCAGCGAATGTGCTTATCCGATGATCCAGGTTGCGAGTAT
CCAGCAAGGACTGAAAGCCGCGAAATTTGGTTCGCCAGAACTTCTCGCACTTCGCGCGCGAATGCCCAGCTCCCAGTCGGCGCAAAACTGACAGTAGAGC
TTTGAACAGGATAGCAGAGCATGCTAAGCATGGCGCACCCGCTTTCTAGCAAGGCATACAGATATGTTGGGTCGCTCTCGCCAATAGAGATGGCCAGGTT
CTGCACCTCATCCCCCAGAAGCAGGAATAACTCAGCAATCTTGCTCACTTCGCAGTAGAAAACATCAAAGGAGTTGTAGCCCGCTAGACGCAACTGCTCT
TTCTGATAGCCACGTTTCTCCACGGTTTGTTCAATCGCGTGCAGAAGGAACTTACCAGTTAGCCGCCGTTGAATTTTTTCCACCTCCGATGAAGCTTCAT
CCTCTGTACTATTAGACAGTATCGACGCCTGGAATTTGCTTAGAGCGattgcagcctgcagcttctcgtcaTTTTCTGTCAAATATCGTTTCAGTTCGCT
GGAGTTTTCAATAAACTCCCAGACGGATGCacagcgaagctgcaggaactccatAAGCGCCACGTGACGACTCCTCTTTTCTTCCAACTGGTAACGCACC
AGCTTGGGTGTGACCGAGGAAATATCAGACCCACCCTTCTGGACATCGGCCTGTGGTGGAGCTTCgtcgtttgctgctttctCCCATCGCAACCCGGATG
ACGATTTAGCATCCAGGATCTGGAAatccacagccacagcagcttgagcaacaGAACCCACATCCTTTGCACTAACGCGCAGCGCGGACGCGGAGTTCGG
GTTTTCGTGAAAGTGCGTCAAGATCAGACGAATGTAGTCGTCCACACTAAGATTCTCTCCCAAAAAGTGAGACGATTCGCTCGTGTAGTAACTTGCTTCT
TCGCGTCTCCGGCGTGTCCTCTCCACAGATGCCTCGGACGGTGTTGGCACCGCCAAACGTTCCAATTTCTGCATATCCGATGCAGTCGCCAAACATACTG
ATCCACTCAGTGATTTCATATCCTCTTCCATCAGCAAGAACGACACCGACCCTTTCACGGCGTTGTTATCAAACGAACTCTGGTCTACGCGAACCCCAAA
CGCCAGAGCCAGCCGACCTTGAGATCCTTGCAGTGGGAATGCAGCCGAGCGCACACTAGTCTGTCCAGCTCGCGGCAACAGAATGGTGCAAAACTGGATC
GGCTGCATGTGCGTCCACACAAGGTACAGGGCTCCGCGCGTGATGGAAAAGCTCTCGACCTCGAAAAACCTATTAGCGGCCTGATCATCAAAGGCCGGCT
CAAAGTCCAGCATGCATGCCCACTCCAGCTCTGGTGGGGCGTCGTCATCCATTGCTCCGAGTGAGAACTGGAACAGCGCGTACTTCACCTTAGGATCGGT
CCCAGctcgcgacgacgagcacacAAACGCCACTAGTAGTGCAAAGCACGTCTCCTGGACGTAAGGCATCGACACAATGTACACCTTGGACAAATGTGCG
TCAGGAAAGTTGTCACTGAAGTAACTGATCGCCACACGACTAGCATCAAAATGCCACTGCGAAACACACGAACAGTCCATCACATCCCCCGTGCTAAACG
TGCGTCGCTCCAGCATGCCGTCCtggaacagcaccaacatATCCGCCGTCTCATCAATCTCTCCTCCACTACTACTCATCGACGTTGCGTCTCCCAacaa
cgacggcagcacTCTCAAATATTTAATCGGCTGATTCACATCCAGTTCCCCTCCATCCGCTCCTGAcctcgacgccgtcgaagagaagaaaaactGCGAC
ACCGACTTGGTGATGCCCGACAAGAAGCCCACACTCTGCTTCTCAAAGGCTCGTACCCGAATGCGGCGATCCTCCACTGCCACTTCCCACACATTTCCCT
GATTGCTCCAACACACCAACCCAGTGGCATCTTCTTGaatgtcttcatcttgctcTCCTCCGCTCATCACCGCGTTAGGGTGCGTCGTCACTTCTTCGTT
AATCCCCAACGGGATCTGCACACTAAGTGGCACACTCTCATAGGGCAGCTCAATGTCCTCCCAGAAGAGCACGATGCCGCTTTTCCCCACGATCATAAGA
CTCAAACTCTGACTATACAGAGCGAACACAAAAGggtgcagctcttcgtcgacctccagctcgtcaGGCAATTGCAGTGCAATAACTTTGCCTCGGTCCT
GCTGCCATAACAAGATTTTGGTCCGTAACGGGAACACAAAATATGGGACCCAGTGACGTCCGCTGCGATGACGCGCCGAGGGCACCGACGCCCGACAGCA
TCGCACTTGGTGACGCTGGTGTGTCGGCAGCTGCGGCCATTGTTTACGTAattcttccagcacttggGGCGGCAGACGCGCGCCCTCCACGATGGTGCAG
CTCCGCGAATCCACCAAAAGCGACGAGGCTTCGTCTGCGTCCAGTTGGTCGCTGCCCGAGCGAGGCGCGTACAGCGCGTCCCAGTGCTCCAGACGCTGCC
GCTTGCTGGCGCTCAGCACGTCGGTGGATAAGAGCCCAGCGCCCACGCGCTTGGACGGCACCTCGACGAACTTGCGAGCCCGGAACatg