Description :
From Genome Similarity Track
Location :
Scaffold_1590:259- 4256
Sequence
3997 bases(100 bases per row)
TTAGATAAAATACTCTGGTACTGTTCTCTAGACATGGCCAGTGGTTTCTGGGTGGTTACTATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACAC
CGTTTGGCCTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTGATCGATAACGCCCTCTATGGATTCACCCG
AATACCGGAGCCCGAAACGGGTGGATCCGGGGAAAACCATACGGAAGTGGATCCATGTAAGCGGGGGAACCAGGGGATCCCAGGACCCCGCCTGTGTTAG
GACGCAGATCTTACATCGACGACATTCTAATCCCGGCGGAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGAAGGCGTGTACTAAGTGGAA
TCTCTCTATCAGTGTGGTAAAGATCTATTGGGGGATGCGCAAGGTGGATTACTTAGGTCATCGAGTCTCCAAAGGAGGGATTGGAGGCGAATCCTAAGGA
CCTGTCTTCGTTAGCAGACTTGTCCTTCCCACAGTCGTTACGAGCGATGCAATCCTCTTGGGCAGTTTAAACTACTATAGCCGGTTCATCGAGGATTACG
CACTGTTTGCTGCGGTACTCTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTTCAGCTGTCCGGATCAAAATCCACAAGCTCTGGCCCTGGCG
ATATCGGACCACGAAGGGATCCAAGTAGCACGACGCCGGAAGAGTACCTAAAAATGGAGCTGGATCCACCCCGGGACCAACGGAAAGAGGATAGAGACGG
CGGATCAGAACTTGGAAAGGGTGGAGACTCGGTGGATCCGAGCTCGGCACGCGTTCGCGGAGCTAAGGAACAGGATCGCAGCGACGCCCATCCTCCGCTT
TTTCGATCCGGAACGTCAACCTACGATGATAGTGTATGCCAGTGACTGGGCAGTCTCAGCAGCCTTGGTACAAGAACATGAGGGGATCTGCCATCCAGTC
ACCTTCGTCAGCCGGACGCTAAAGCCGAATGAGCTGAATTACGGAGCAGTGGAGAAGGAGATACTCGCGCTCTTGCGCGTGTTGAATCTGAATTACAACC
TGTTGGTGGCAAGATCCATCCGGATCCTGACTCGACACTCTACGCTAGCTTGGTTGTTCAAGTCGGCCGGTTTACAAGGACGTTTGGGACATGGGCAGCT
TTACTCTCACCTTGGACACTGGAGATTGTGAAATGTTCGAAAGAAGAAGACGAGATCCTGGGAGTGTTGGCCGCGAGCATCACACCCAGAGCCGAGATAG
ACAAAGCGCTGACTAGGATCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCGGATCCCGACGGTACAAGTGGATGAGGATCTGTACGTCCTAAG
TTTCGATGGATCCGCTCGCGTACGATGCGGAGGAGGAGCATACAGCGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTAT
GCGGAGGGCCTCACCGTCAATGAAGCAGAGTATAACGGGCTCCTGCTGGGTTTGGATCTACTAAAGGACAGGATCCAAAAAGGCTGGTGATTTGTGGGGA
TTTAAACTTGGTAATCAGACCGGTGCAAGGGTGAGATTGACTGCAAGGCCCCGGCCCTAACGCTGTTACGGCAGAAAGTGATGGTCCACCTGCGTGGTTG
GATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGTGCCGCTTTACGGAATCAATGTGGTGTCGAAGTGGAG
ATAGAGGCCGAGCATCAGGATCTCGTTATGTTGAACCGACTAAATGAGGTGGTGGTGGTTGGATCCGGAAAAAGGACAGTCCAGGTAATGGCTGTCACTA
GGTCCAGAGGAAGGATTGGATCCAGCCCCCAGATTCTCGATGAAACATTTGTGAAGGGAGTCCGCATTAAGCGGATCCTTAAAGCACAGAACAAAGAAGC
GTGGGATCTTGTGAATATAAAAAAAAATAAGTGCGTGGGGGGGTGTAAGAGGGCCTGAAGTCCGGGAGGATATCCATTTCCTACAGTAATTATCCCTAGC
ATTACGCAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGCAAGAGAGTCAACGAGGGTCGGGATGGATTGATGAGACTGGTGATGCCGGAAA
CCTTACAACAGGATGTCCTACATCACTATCACGCTAGTTTAGAAGGTGGACATCAGGGACTTGGTCGGACCTACCAACGGATCCGGGAATGTTTCCACTG
GAGCGGACTATTCAAGAGCGTGCAACGATATGTCGGTGAATGTATGGGTTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCCGGGAAT
GTCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCACATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATCTGGGTGGATC
TGGTTACCGGATACGTGATAGCCAAAGCTAGTGCGTCTAGAACGGCACAAACCATTGCCGAATCGTACGAGGAGTGCGTTTTCCGAAGCTTTGGAGCTAG
TGAGATGATTAGGCATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCTTTCAACCGGATCCTGGGGCAGAGACAGCGGGCAACCATGGCATAT
CGTCCCCAAGCTAACGGATCGGCCGAACGCATGGTGCAGACAATCACGAGGGCACTCAAGATGTACGTCCAGAATTTGGATAAGAGGGATTGGGATGAGT
ACGCAGAACGACTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGACACCCCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCT
AGAAGCGGTCATTCCGGTATGTAGCACCAAGAAGAGAAGCCGAGATCCAAGACGATGGCGATACCAAGTCCAGAAATATACCGGCAAGCCAGATCCCAAG
TGAACGAACGGCTGCGGAGTGCGATACAAGATCGAGCTCATCGACACAACGAAGACGCCCGTCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTA
TTTAGATCGGGTGAAGGAAGGGTATGCCCACAAATTGGCCCATCTATGGCACGGACCGTTCCGGGTGAGCGAAAAAATAGGGGAACGTGCGGTGAAGTTG
GAAACGGCAGGTACCGAATATCGCTTGTTCCCTGTAGTACACGAATCCAAGCTGAAGTTGGTCAAAGAATATCCGGATCGGCCGCAGATCCGTCTTTCGG
TGGATGGATCCGATCGCGTCGACTTCGACGAAGACCTCCTACCGGAAGATAGCTGGAATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCAC
CGATATGAGGTCAGGGAAGCGAACTAGATACGGGCGGATTTACCGTGAATTTCTGGTGTATTGGCGTGGATATGACGAGCCCAGTTGGGTAGACGAGGCA
GATCTGAACTGTGGAGCATTACTCTATGATTTCTTGAGGGATCGTACGAATCGTAACAGATTCGGCGTGATGTAGTCTCATGAAGAAGAGTAGGGAGGGG
ACCCATGGATGTGAGTTGGTCATGTCGATGGGAGGATGAAGAAGGGCCCACAGGAAGGGTGTGGGCCAGGAGGAGGCGGATCGCTGATGTGAGTTGGTCA
CATCGGAAAGAAAGAGAAGACGAATCCACAGGGGAAGGGTGGATTAGGAGGAAGGAGTGAATGTTTATGCATAAGAGTGACGTTTTTCGTGTGAGGAGTC
CTGCTTGATCTCAAGCACGAGCTTTCAAGGGCCCGAACTATACTGACCCAATTGAAACTGGGTCGTTGGCGCTAGATCCGGATGAAATCCAAGCGTGGAT
CCAGCCGGATCCGGAATCCAGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCCCGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCCAGCTCA