Description :
From Genome Similarity Track
Location :
Scaffold_569:259- 2028
Sequence
1769 bases(100 bases per row)
ACGACCTTTCCTGCTTTGGTTTCCAGTGCTTCGGTCGCTAAAGAGTCAGCAGCCGAGTTGTAGAGACGCACTACGTGGAGGTAGCGAACTGAATTCAACT
TGCTGACCAATTTCTTGTGGCGTGCTAACTCGACTTGCAATGCCTCCTTCTTACACGCGATCACCCCCATGGATTGCTGGATCGCAAGCCGGGAGTCGCC
CACGATGATCAAATCCGTCACCCCGCGCTCAATGGCCGAGGTCACCCCATTGTTCATGCCGGTGTACTCGGCTATATTCACCGTGGTCGATGGGAGGTGC
GTGCTCGCAGCGATCTCAATGTTCCAGTCTAGCAAACGCCACAGGATCCAAGAACAACTCCCGAACCCGCCGTATTTAGCAGTCTTCGCCGATCCGTCAA
ACGACAGGACGTGTCCCTTGAAGTCTCGGGGCACATGCGCATACAGCAATTCTGGGTCCATGCGGACCACAGCCGAGTTCTTGGACGGTGGAGTGACATG
CGTTAGTAGCTCGTCCAATCCCACTGCCGGCGTGATGGACGCTTGGAGCAACTGGGCGAAATCCGTGTCCCGTTCGCGGACCCGCTTGACCTTTAGGTGG
AACGGTGATAGCAGTACCGCAAAGCTGACTGCTCTGCCGTAGAGAGACTTCGACTGGAACGCCCATTCGAGAGTCGAGTAGCGGGTATAAACATGGATGG
TCTTCCCGGCGAGCAACGTGTGGCACACCTTGATGAGCTGTAGCAAGGCGAGAACTTCTTTCTCGGCGGGATGGTAGCCGAGTTCATTATCCTTGAGGAC
TCGGCCGCAGAACCGCACTGGATGGAGCTTCCCGTCGTGGAGCTGCATCAGCGTGCTACTCAGAGCCCACTCATTGGCGAATAGCATAACGTGGACGTCC
TCAGCCGAGTTGAAGTGGCGGAGTATGGGTGCGTCGACCACCTGCTGTTTTAACTCGGCGAACGCCGCTTTTGCGGCCGTCAGATCACCGCCGGGTCCGA
AATCTTCGTCCTTCAGCTGATAGAGGACCGCCCCATATACAGCCAGGTTCTGGATGAACCGGCCGTAGTAGTTCAGCGCTCCTAAGAATGCTTGCATCCC
CTTCTTCGTCGTCGGGAACGGTAGCCCGGCTATGGCCAGCATCTTTTTCTGGTCGGCTTGGATTCCAGCCGAGGTCACCCCATGTGACAGGAAGTCGACT
TTAGGTTGGACGAAGATGCTTTTCAGGAAGCTGACGCTGATGCGGCATTCGGTGAAGCGTTGCAGCAATCGGTCAAGCGTCCCCAACCAATCGTCGAACG
TCCTCCTACCGAAGAAGATATCGTCCACAAACGATCGCCGGTCGAAAACCGGTGCAAGGTACGATTCATCAGGTTCACCCGTCCGGAACATGTCGGCTTC
TGGGCTGTTAATGAATTCTTCCAATGGGTCAAACTCAGCTTGAGCTCGGCGGTCGGCCTCAAACTTGGTCTGGCCACTGGCTTCAAAGTCGATGTCGGCT
GCGAGCCGTTTCCGCTGAGCTTCTGAGGCGGCTTCCGCTTGTTGGATGCGCTTGGCGAACACATTCCAGCCGCCCTTGGGTTGTACGTAACCCCACAGAG
CGTTATCAATAAGGCGCTGGTAGATCATTGGGGCATTCTTTAATCCGAAGGGCATCCGCAGCCACTCGAAGTGGCCAAGCGCGCAAACAAAAGCCGAGAT
CCAACGCGCCCGTCGAGTCATCATGACCGCCCAGAAACCGCTAGCAGCATCCAAAGAGCAGAACCATAG