Description :
From Genome Similarity Track
Location :
Scaffold_306:259- 1812
Sequence
1553 bases(100 bases per row)
CACTACAGACAATCGTTTCAGATCAGCCCTGAGATAGTTCTCAGttgtCACAATATCGGCCTTCGTATCAACAATATACATTTGCTCAATTTCAATCTCA
TCTTCGAGTGCCACAACGAGGTCCTTcgTGTAAAATCTTTGTAATCCGTTCTCAAGTACGTCTGAGTCCATTTGAGGGCCTTTGAACATTCGTGCTCGCT
CGAGTTCGGCTTGTTTTTCAATTATGCGACCTTCGGCACCTCGAATAAGAGCGACGAGATCAACACGGCGATCTTTACACCACTGGATGTTATACTCGAC
ACGGCGAAGTTCTTCCTTCAGCGCTTCAATCCGAAAATGAAACTGCCTCCGTCTCTCATGTATTATTTCATCTTCAGATAATTCATCGAAATGGCGACGT
TGGGGCTTGTTCTCTTCTTGGTCGTTGCcACTTTTTTCTAcTGATGCTTCAGGTACATCCGATCGTTCCAAAATTGCACTTACATGCGACTCAAACTCTG
GATGCGTCGAGAGTATAAATTTTGACACCAGGCTGATATAGTTGTTTCTTTCATAGCGTTGCATGAAACCACTTAaGAATTGAGAGTCAATTATTCGAGT
CCGAGCATTCACTGCTGCCTGGAGTTCGTCAAGGAGCCTGAACTCATTACCAGGCGCTGAAATAGTTAAGAATGATTAGTGCCAGTCTTTCACACAGCTG
GTAGGAGCATTCGTACCGATTGTGAATATTGATGCTATAGGGtcGCTGAACGCTCCTGGAATGCCAGATGCGTTGACAGCACGTACTCGAAAGTTTTTAT
GTTCCTTTCCGCTCAGTAGATTGTCAATCATGAACGTAGGGTCCGATGAATACGTTCGAACAAGTCGATCTTTATACACCACTTCAGAAAgATCGAGATA
GTTCTTGTCAAATGCGACCGTCTCCTCCATGACTGCCTCACTAAAACCAATTTCGTAGTCTACGATGTGCTTTCCACCGCAGTCCATTGGTTGGGTCCAT
GACAGGGTTATCGTTTTGGCGGTCACTGCCCCAACAGCAACGAACAGTGGGGCGGTTGGCGCAACTGGAGGTAATGTTCTCAAAAGATCAATCACGTTGC
TTGGACTACTGATGCCTGCTTTCGTGATAGCAGATATACGAATGATCCCGTATTCTTGATCAGCATTTAGATGAGTCAACGTGTACTCATTTGTACAGAC
TGGCCTCACAAGGCACCAGTgAGATGTTCGAATCGGCTGAGTCGGTATGTCCTCACGAGCGGATTCTCCACTCTTTGTTCTCTGCCAGCAAACGATTGAG
AACTCCAACAGAAAATCGATGATGGGGTATGAGCCAGTAAATATGGGAtGGTCCCAcTGAAGCGTAAGCGAATTATGTGTTGCTCCGCCCTCTTCGACAC
GCAGATTTCGTGGAGGTTGAGATACGAACCTTGACAGCATCCGCGTATCGTTATCTAATAGTGATGGATGCACGGCTCTTTCCTCGTCACTTTGATTACT
TCGCTGCTCTGTGAAATCGACACCGTTTCCTGACATAAACTTCCTACCGTCAC