Description :
From Genome Similarity Track
Location :
Scaffold_97:25898- 36520
Transcript NameFunction/comments
Phyke_g4228hypothetical protein
Phyke_g4229hypothetical protein PHYSODRAFT_506421
Phyke_g4230hypothetical protein PHYSODRAFT_560624

Sequence
10622 bases(100 bases per row)
GTTTCCTCCACCACTTTTGGATAGTGGTGGCGTATGCATTGTGCCACATAAACTGGAGGATTTCTTGTCGCCGTTGGTCCTCCAACCGAACTTTAAGGCC
GTAAAAGCGAGCTCGAGCTTGTTTCGCTCGATAGGCATTCTGCAACAAtacagcagctgctgttttCCTTTTGCTCGCTCGATCCACTCGCAGGTTAAAG
TATTGAAGAAATTTCACGTGCCGGAAAAAGTTGAAAAGAACTCGTCGAGCTTTTACCAGTTGTTCATATCTGGCCTCGCGGTGTCGTAGTTCTGCCAATG
TTCGTCGCACCCAAAGTTGAATTGCAATTGCGGCATGATATCGTGCCAGATGGTGGAGCCATGAAGCCAAATCTCGTTTTTTCTCCACGAAAATTGTCAT
TGATCGAGTGATAATTCGTGCCGCTTTTTGGGTTTTCATCCAAACAGCACAGCGCACTCGGAAAATGTACGAACGATAGAAACGTTGAACTTGCCAGGCA
GCAGAATCGTATCGGAGAAATCGACGTCTTCGTTTCGTCATTTTCCGGGTGTAGAACCCTCTCCAATTGGATTGAATAAGGGTTGTGCCTTGGTGCAAAT
TGtggacagctgcagcttgtctACCCCTCAGACCTCGCATCCAACTTTGCAttgtcactgcagcaacaaaaaactcgtcttcttgttcatGTGCGTTGAA
AATCATCCATCGACCCCAAACACGAAACACCAAACGCTCCAGTTTTGTACGAAATCTCTGTAAAATCCAAAGTGCACATTTCCTACAAAAACCATATATA
CGGTCAGTAATTCAGTACTGTTCGTTTAGGTATATATTGTAAATGAATGTGAAAATAGAAGTAAACGTACAGTTGGCAAAACCTGCGCACTTGATCTTGG
CATCGTGCCCACAGCATACGTTGGCGCCAATGAGCGAACcgatgacgctgctgttggtggcaATGCCTCGACAAGGTAATCTGGTTAGGAGAAAAAAACA
TTATGAGCTCAAATACGGAGTAACATTGATCATGAAAACTCGAACCGATAATTTTTCGACAGCAAATTGCTTCCGCATAGCGCTGGAGCGCGTGACCTCT
TCTGTGCAATGATCGCGAACCCAGTCATGAATATATAGCGGGCAAACTTCTATCTCCATGAATAAGCAAACAACAGTAGAACATTGGTGAGTAAAAAAAC
TCTCACGTACCTCAACAATAATCGACTCTGATTATCGAATTCGTGCATGAAAGTTACGTACGCATCTCTGTGGGTTTTCGCATCAACCGCTGTATGGAAG
TTCCTGAGATCGCTTGTTGTGTAGCTTCGCGGCTAGTACATAGAGAATCACCGGCAGCTTGCCTTGAGTCACGTTGGAGTAGTGGTGTCTTTTTACGAAT
GACAACCGCTGGAAGCAATTTATTCCCTGTGCTCGCGAATTGAAATGCCCGACCGTGTATCCACGCATTTCGCACAAGCATTCCACATAGTGAAGCGGTA
CCCCACATACTTCGCGATAAATCTTTTGACGCATGGGCATGACCCCGCCCCTCTTGTTGGCGGAGCATCACAAGTGCCATCTCCAACTCCATGATCTGGT
CGTACGAAATCCGTGTTTGTCGAAGAAAACTCGCGCTTTCCAGTATGCTAGTGACATCCGGTCGTGCAAGAAGGAACAAGACGTCTTCGATCTCTAAACA
CTTTAGACGAAACTTGTCCTCCCAGAGTGATAGCACATGGTCACGAAAGCTACTGGGTGGTGTGCGCAAACTTGAGAGGTTGTTGACCACACCTGGGTGA
TGCCTCGGAACTCCCGCTAGTAAAGGCAATACGGCAGGAGAGCTGAGTGGTGTGGTAGTAGTTTGCACTGCCGCCATTGCTCTGACACATTTCCTATCCT
CAGAAAAGTGAACGTTTCTGCGTCTTCTGTTGTTACCAGTCTTGTTCTTCGGTACCTGCGGTTCAAATAAACGTTTTGCCTCACACAAAGTCCTCTGCTC
AGGCAACGTGTCGTTCAGGATGGCCGCTACACTCCATTCTGCCCCATTGAGAGCACCAAGACGCTCTATCAAACCACAAGACTCTACGTAACCATCAATG
ATCAATACGATAGGATCAAAAGTCAGGACTTGATCACGTTTGGTATTGCAGTAGACTTAGTAATTACCAGCTCTCCCGCTTCTCTTTGCACCAATACTCG
CAATATTGGGTTTCTCCTGCATGCCTCACAGTAGCATCTACTTGCTGCGAGCTTCATGTAAATATTGACAACGTCGGCCGCTAATTTTGGAGTATGCTTA
TACCCCGTTGTCAAAATCGACGCGTACATTGAGCTCCTTGGCGTCCATAAACTCAAAGAGCTCCAAACATTCATCTTCGCTCAAATACGCACGTAGAACA
CGGATTCCGTCCATGTATAACTCTTTGCTCCACGCACAAGCCGCGATTCCGCGGTAGAACACTTTCTTTGCCGCATCAACTTTTCCCAGTGCCACTTCAA
AGCGCAGATACAGTCGCCAGCAAAGTGCATTCCCTTTGGTACGAATGTGGCCCACCATATTCTCAAACACCCGTCGGATTCGACCAACAGCAGTGGCATT
CATATCCCAATGATGAAATAAACAGCATGTAAGGCGATCGGATTTGCCGGTGCTTGATTGTTCGGCGTCgagcaatgcagcagctcgctcgACTCGGTAC
AGCTCACAGAGCAGCGCGAATAACCACTCCACCAACTCTGGCGAATCGTAATGCCGTCGCGAACGCTTTTCAATACGGAGAAAGTGGTTGCGAAGTACTT
GCGATATAGTGTTACCCGTCTCCGAATCTACAAAGAGCCGAAGAAATAATGCGTGTCCTGGAAACAGTTCCACCGCCTCTCCAACTGCCAAGCGCCATAT
CCGAGGAGCTACCACAGGAAAGCACCCTGAGgcttgatgctgctgcatgaactcCAAAAAGCACACCCATATCCATTCCAAATGCggacagtgacgatga
tcaGCATTGTTCACAGCTTGGCGGTACTCTTTACACGCTGCGTCAAAGCCTTGATACGCGTAGACAATCAGTGCAAGGTTATGCAAGCAGTAACCAGCCC
AGCAAGTGGTTTTGCACCTTGGTTTGCCTGTCGTTCGGTGCTCCTTGCAACTTTCTTCACATCGTTGAATTGCACGGTCAAACTCTTCACGGTATTTAGT
CATCAGTGAAGCTTCAATCGACGGATCCGACATCAATCGTCCTTGCAAAACTTCGCAAGTCCGTTTTCGATATTTCCTCGTAATCATGTCCAAATTTTCC
AACTCCTTGTTGTCAGCGTGCCCAAGCTCCCATGCATACCAGAGCGTATACAGACAGCGCAGTGTACGGAGGCGCTCTTCGGAGCGAGTATACATCAACC
CTGCATTTTTGCTCTTTCGATCAGCGGTTGAAGGCCATATCTCGAGACGAGCACGGAGAAAGACAAAGCGGTGGAAAATCCTGGACTGGGGAACCTTGCT
TGATGATGGCGCACCGATAGCCGCTAGGGTATTATCACAGATACGTCGCACCTGGCGTTCATTTCCCAATCGAAGCTCCAACTTTGCGTAGGCATACAAA
ACGTCAAAATCCGTGCCGCCGTTACAAGTTGTCTGGGACAGCTGCTGACTCAAATGACGAGCATACGCCAGACTGGGTTCTTTACTGGTGCTAACTCGTG
CGACCTCAGCTTCGAATCCAATCCACAGACATTTGAGTGTGCTATGGAAATCGTGATCCTGGTCCTTATCTGTAAGATCAGAAACACTTAATGCTTGCTC
AAAGATTCGGCGGATAAAATCCACTTTGCTCGGGTTGTAGAGCAAATTTTCCTTCGTTGCAACGTCTTCAAGAAGGGCCGTCTCTAACAGCAACGTTCGG
CCCCAGGGAGAAAGCATCAGAGCTTGATTTTTTGCGTGAGGGTTCAGTGCAGCCAGAATAGGTGCCACAAGTAGTTCATAGTCTGAAGTATTGTCCGCGT
ACAGCACGTCGCGAACTTGTTGACTACCATCCCACGCATATTCATTACGCCACCCAACGCCGCAAACTTGTAATAATTCAGCAATGAGCCGCCAATGGTA
CTCCTTTGGTACGGAAAACAAAAATGGCTGAATTTCTTCTGTCAGCGTAGCACGGTCCGGTTGTTCCTCAATGAGCTCTTGGTGAAGAGGATTACTGGAG
CGTAGGGGAGCCCATTGCATCTGACTTTGCTTTTCCTCACGCATCAACCACTTTACGAAGTCGTCGTTCTTCTCGATCGAGGGGTAATTCGAGCGTTGGT
CCTCTACTTGGGACAACGTTGAGGCAAGCACCGCACGTTTTCTGTTGTCCCTTTCTAATAATTGGTCCTGCCGAGCTCGCGCGCTTTCCGTACCGCGTAA
CTCGCTTAAAATGCGCTCATACTCTCTCGTGtcgtcagcatcgtcgacgctAATACGGTAACCGTGCAGGTTGCTATAAACAAGCTTACCACTTTGTCTT
GAATCCGATTCCTCCGCATCGCTTGAGACTGATCCGGCTGTATTGATGCTAGAGCTTTCGCTGTTTTCGCCGGCATTTGCTACCATTTTAACATTTGCTT
TGCGTTGGTATGTTGCAGAGCCTGATAAAAGACTTTGTTTGTGCGCTGTAGTTCGTAGTGTTTCGGGAGGACTTACTTGATCGAGCGAGGTGGTGCAAGA
TGTTTGAATATGCTGCTCGAACGACGTCATTGACGGCTGGAACGGTCTACCCCCCATAATGCTTCCATCCCCATCCAACGCTTCGTCGCCAAAGCCTATC
GCGCCAACTTTATCCCACCGTGACGCAAATTCTCGCAACATTTCTAAGTAAGTTGGTCTATCACCACTCCCCGGCTGTCTTGACTGCCCTTTCAGACTGA
AGTCGATCAACGCTTGCAGTTGAATGATCGAGCGCTCGACATATCCAGCCTTCATCTCAAAGGTGCACATGAGAAAGTGAAAATCGAGCAGCAATCCCCA
CAACTCCTGCACATGAGTGGTAGACAGGTTATTCTCGACATTCTTCTCTGACATCGTCGATGACATCACAATACTTTCGCTTTCAGCCCTTAGAACAGCC
AGTATCCGTGCATACAAGTCTCGTACAGATTGCATGGAAAAGTTTCCAAAGTGTTGCTGGCGGCTCTGAATAAGGTTGAGCCACAGGTTGCTGTTTGTAG
TATCTTGAGAGAGAAGATCTTCCAGCTGTCTTTGGATCGAGTCCAAATCGGCCCTATCGCCATCCGTTTGCGCATGCAGCAACACGTTGAGCTTCACGCG
ATGCAATATACGCGAATGAGGGTTACTCTCAAGTGCCCTGTCCAAAATTGCGGCTTGCTTTTCTTCGACGCTTGTTTTCACAGCTATGCTCAATTTCTTG
CCTTTGGTCTGAAGACGTAGCGTCTCGTCTTGGAAGGCGACAAAATTAAGCCAAGTATCGATGTCGTGCGGGTTTGCTGTCAGTGCTGTGTTAAACATTT
TGGTTCGTGCCACCAAGTGTTGCTCTACATTCTGTGCATCCGTCAGCATAACGCCCTCTGGAACATATCCGTGACCACCTTCTCCCTCCACTGTGTCGCC
AACTAACGCTTTGACGTTAACCACAGGGTCTAGCGGGATGAATTCCATCCCTGTCGGGCGTTCTACGATTGTTTTTGTAGACCGTTCACctccttggtct
tgaatCTTTACCTTTCCGTTGGCCTCCGCACGGGCCAAGCGTTTCTCGGAGTAGGCAAGATACAGACGCTTCTGTCGAGCATCTCTTTCCATTTTGCGTG
CTTGTAACGAGAAATATCGATCGCTCCattgtttttcttccttctTCCCGGATGGTGCGCCGTTATACTTCGAACGTGATGAAGATATCCATGCGCCGGT
AAGAAGGTTGCGCCGTGTTGCCAACTCGTATAGTGGCTGGTCGTGCACATACGTGGACCCGTAAAACTGATTGTCGAGGTCGCCTTTGCAGTCCATCTCA
AAGATCTTGTTTTCGGTATCCACCGGTACTTGTTCGTAACATTTTATCTCTTTTGTAGGCTGCTTCACGATCCGCATTTCTTCACGATGACTTCGTGATC
GAGACCTGCTGCGACTCCGACGCCGATGGCGTCGAGATTGATGACGGGAGTGATGTCTCTCATTGTCATCACTACTATCAGCGTAGCTCCGTTCTCTGGG
GcgtttcttgtgcttgctcttcttcttgtgctttgaATCGAAATGAGTCACAGATTCCTCCTCACTGTGtcttctttttttctttttcttctcttcatGC
TTGTGTTTACTACGTCGATGCTTGTATACTTGCAGTGATGAGTTCGTATCAACTGTGTCGGTGTTAGTTCCACCGGAGAAACTCTTGCCAATTTGCAGCC
AATCTATTAAATTTGTCAAAAGACAATTTGATATACTTAGTTAATCGTGTGTGGGGAAGCAACCGACAGGAATCATGCATGGCAGAACACACCGTCGTTT
AGCTGGGCGTTTAGAGAGTTGTTGTCATAGCTGTCTGTGTTTATATCGTCGTGATTATCGCCCTGAGAGCCGCTGGCCGTCGCCGCCTTCCGCCCTGCTG
CGAACATAAGTTAGCGCGAAAATTGCGATACAAAAACAGATGAAAAGATGCCATTTGATTGGTTAACAAACATTTACATTGGGATATTTGCATTCACACA
TTCACATTCTAGATATCATTGTCATGAACCGCGAGAAGGACGCAAAACAGTCCCCTGTGGACCCTTCGAGCGAGAAGGACGTCTCAACTTACATTAAACA
GAAGATCCGCGTGTTCAACAACTTCCCTAAGCCTGGCGCGGTCTTCAGCGATGTCACATCGCTACTACAGGACCCCGAGGCGTTCCAACTGGTCATCGAC
GCTCTGAAAATCCGCTACGCCGACCAGAAGATCACTCACGTTGTGAGTTGCGAGTCCAGAGGCTTCATCTTTGGGGCAccgttggcgttggcgttgcaAG
CTTCTTTTGTACCGGTTCGTCGCGCCAGGCGACTGCCAGGAGATGTCGTGGGAGTGGACTACATGTCAGGCTTCTACACTGGACGACTGGAGATTCACCA
GGACGCAATCCCTAGCGGGGGACGTGTGGTGATCATTGATGACCTCGTTGCATCGGTACTGCGTACTACAGACGGTAGCATTTTGGAAGAGAGATTGACT
ATTTTGCATGGATATTGTAGGGCAACACGTTGAAGGTGACGTGCGAACTGGTCCAGCAACTCGGCGGCCAAGTCGTGGAGTGCGGCTGCGTCATTGACTC
GCTGCGTTCAACGGTACGGATGCCTGGCAGGCAGTATTACATTCGTTGCAGGAAATGCAAGAGGAGACCATAATGTACTGACCACATTTGCTTTCCGTCT
TCGCTAAACAGGAGTCGCTACATGACATCCCGCTTTACAGTCTGACAAAAATGTGATCAGGTAGCTTTCGGTTCGCTGTGTCGACACCGCTGGTTTGAAA
GCGCTTCGAGTCAGGTCAACCTCGCCGCGTAGAGTATTGACATTCCACCTTAAAACTTCGAATCACAACTGCTATCCTGTTTAACCTGATAGTTATTCCG
TCCGTTGAAATGAGTATATCTGCTTCCATTCTTTTATTGTACTATGTTACATTAGTCTGTAATTACTGTCTCTCATAGCTGATATGCATCatcttttttt
ctttcttttccTCTGTACTGCCTCCATTTTCGCCACTACTAACCCACTGGAATAAAACCCCGCGAAACAGCCAGTCGCCTTGTAAAAGCAATAATGCCCC
CCAACAAGCCTCGTATCCGCCAGCGCTTCGGACCCAACCAGGACTACCTCCTGGCCGTCCAGGCAAACACAGACGCACCATTCCGTGCCGCCTACGGGAC
GCTCATGAGCAGCTGGGAGAAAGTGGCCAACACGCtcaacagctgcagcgccttcAAGATGCACCACCTCAAGGGACCCATCGCCAAGAACCGCTTCGAA
CGTCTCGTGGAGCGCCATCGCGAGTGGGTGCAGAGCGGCAGTGTACCGGATGATGCCCCGTCTCAAGACGTTGCCTTCATGACCATCATGAATGAGCTGG
TGCCCAAATTGAACGCAGCGGAGGCCGAGCAGCTTCCAATTTTGGGTAAACGTGGCCGTCCCAGGAAGATCCGATCGGGGGATGCTGTGTCTGTCCCAAA
GGAGAAGCGACACTCCACGGAGTCTACGGAGCCAGCGAGTACGGGCTCCACCGCTACGCTGCGCTCGGTGTTGGCCATGGACACGCCAATTGTGGGGCGT
CAACGGTTCACACCTGATGACGATCTCATGTTGATCCAGTTCGTCAAAGAGAGTCTGCCGTTCCGTGCCAAGTTCGGCAGTATCTGCTCAGCGTGGAATG
ACGTGGCAGCGAAGCTGGATGCGTGTCCAGAATTCTCCAAGGACAGTGTCAAAGGGCCGATTGTGCGCTACCGGTTTGAAAATTTGGTGGCTAAACACCG
GGAAAGGGTGAAGCGGAATAATGGACATGTGGTTGGACCGAAGGGTGCCCCTGCAGGCGAACTGGAGGTCATCATGACGGAGTTAGTGGCGTTGCAGGAT
GGAGAGGACGCGGAGAGTGCCGCTCAGTTGGCTCAGAGAGTAAGTGCAGCGGTCGCTTCAGTagaagagcaagatgccgatgccgatgccgatgccgatg
ccgatgccgatgccgatgccgatgccgatgccgatgttgatgctgatgctgatgctgacattgatgctgatgctgacgctgaCATTGATGCTGTGAGCGA
AACGAGTGAACCTTCTGCTAGTCCGAGcttggaagaggaagaagaggtggtGGAAATCCCCACTTCAGTGTACCCTACGCCCATTGCCCCCTCCCCAGTA
CCAACTCAGAGTTTCATCCTCCCTGCACCAGTCGCTGCTACCATCGACACTAGCGACGCTAGTAGCTTCGCTGGGCTCAAGGTGTTGCTCCAAGAAATGG
TGAACCAACAGGCTCGATCCATggagcagatgctgcagttgcatcAGGAGTTGTATGATCAGGAACGCGAGGAACGGCGCTTGGAGGGGCAGCGGCGACA
GCGCGAGCTCCAACTCGAGCGGGAGGAGCGCGAGAAGGACCGCCAAGCGCTGACGAGTACCGTCATGTCGGTAATGAAGGCGTTCTTGGAACAGAACTCC
CGTGACTAGTTATAGCGAGCAAGAAGTATGAGGTCACGTTGAAAAAGGGCCCTACGTGCGTAGGAAGCACAAAGGGTGCACGCACTTTGGTATTGTTAGC
ATCACCAGTCATTTGATAAGCTCCCTCAATTGCATGTTCACACGAGCAAGTCCCCATTAGCATGGACGCAGTTTGAAGCCTCTGCCCGGCAGCTTCAACA
AAACTGCGGGGACGATTTGCTGGTAATTTTCGTGTTGGCGTTTGGCCAGATGGATCAGATCACGACTTTGTAGCAAGAAAAGGCGAAGTCACTCCCGAAG
AAGCCTCAGAATTGAGAAGAGAAGTTCATGTTCGGCTGCTTAGcaagctcctgctgcggAAACTGCGCCGGAGGCGACTCcaccaacgacaacagcCGCA
GACGCCTCGCTGACGACGACCCTCGACGCCGTGACTATGACGCGTCGCGAGATGTTACCGTCCAACCGGTCATGATGTCACAAATCCGCCCACCGCAGCC
ACAAGTACGCAAGGACGactgagagagagagagagagagagagagagagactTCTATCGAGACTCGGATTTTGATGCAGATCTACGAGGCAGATACGACA
CGACGTAAATGGCGATGAGTCTTCGTAGAGACAGAGATGTAGGACAATCTAATCGCTGCAGCGAAGAATCAACACTGTTAGAATAGCGTGATGCACACGC
GTTCTCGCGAAGCGATCTTAAGATCGCTAACGAATGACATCTGACAAGCGTCGACGAACGGTGCCGAGCGCACGGGgcacatgcatgtagtaggAATCTC
TAAAAGAGATGGCAGTTTTGAATCTACCCTAAGATCAACAAGCTGTTTGCATATCACACCCTGGTTCCGAGTTCTAGCAAAcatcaagatgaagattATG
AACATCGATTAGAGGGCCGAACAACCGCAACGCGGTCGTGGCATGGTTGGGGAACCAGTTAGGCATTGATGATGGCACGCCGACAAGCCCAAGCTCCTGT
GGCAGTAACCTTCACCCACGCTATCGGCGCGTTTTTGTCTTTGCTGTTTGAGACATGATGTTTACAATAATCAAGTGtacacacgtcacagatgCGTTGA
AGTGCAAAATCGTGGAAATTGGCGAACAGAACGAGCATGTTCATTGCCAAACATTCCACCAAGTGAACAAGCACAAAGGAAGATGTGTTGTGACGATGAC
GGTTtggattgctgctgctgctgcggagACGAGTGCTGCGGGTGTTTAGCGGGCATGTGCTGTGCCTCATGCTGTCTGGCGGGCGCCTCCGCCGGAGATA
ATGATCGAGGACGGAGAGGACACGATTCGCCTAGAGAGGTGTACGTGCAGCCGGTGATGGTACAGCAGGGCCCACCCCCAGGATATGGCCCACCACCTCC
AGGATATGGCCCACCACCTCCA