Description :
From Genome Similarity Track
Location :
contig_27:258893- 261065
Transcript NameFunction/comments
g6983.t1hypothetical protein

Sequence
2172 bases(100 bases per row)
TGCTCAGCGGCCGCTTCCCAGACGGCAAGAACCTCACCAAGGAAGGAGAGGTGACGTACAACGGTATGCCCGCCAACGAGCTGCTCCGACGTCTACCACA
GTTCGTGTCGTACGTGACGCAGCGCGACAAGCACTACCCGTCGCTCAGTGTCAAGGAGACGCTCGAGTTCGCGCACGCGTGCTGCGGTGGTGGCCTGTCA
AAGCGTGAAGAGCAGCACTTCATCAACGGCACGCCCGAGGAGAACAAGGCCGCGCTCGACGCCGCCACAGCCATGTTCAAGCACTACCCGGACATCGTCA
TCCAGCAGCTCGGACTCGACAACTGCCAGAACACCATCGTGGGCGACGCCATGACGCGCGGCGTGTCCGGCGGCGAGCGCAAGCGCGTGACCACGGGCGA
GATGGAGTTCGGCAACAAGTACGTCATGATGATGGACGAGATCAGCACGGGCCTCGACAGCGCCGCCACCTTCGACATCATCACCACGCAGCGCAGCATC
GCCAAGCAGTTCCGCAAGACGGTCGTGATCTCGTTGCTGCAGCCTTCGCCCGAGGTGTTTGACCTGTTCGACGACGTGGTGATCCTGAACGAGGGCCACG
TCATGTACCATGGTCCGCGCGCTGAGGCTCTGAGCTACTTTGAGAGTCTGGGCTTTAAGTGTCCGCCTCGCCGCGACGTGGCTGACTTTTTGCTGGACCT
GGGCACTGACAAGCAGGCGCAGTACGAGGCGAGCTCGATTTCTTCTAAAGTCATTCCACGCGTGGCAAGCCAGTATGCTGATGTGTTCAAGCGCTCTCGC
ATTTACTCAAAAATGATGGACGAACTGCACGGGCCAGTTGATCCGGCGTTGATTGAAGACAACCAAACGCACATGCTTGCTGTGCCTGAGTTCCACCTTG
GCTTTTTGGAGAGCACGATTGGTGTTGTCCGCCGTCAACTGACGTTGCTGTCACGTGATACAGCATTTTTAATGGGAAGAACCATTATGGTGATCTTGAT
GGGGTTGCTGTACGCAAGCACCTTCTACCAGTTCGACGAGACTAACTCGCAACTGGTAATGGGCATCGTTTTCAACGTTGTGATGTTCGTATCACTGGGG
CAGCAAGCACAAATCCCCATGTTTATGGCGGCTCGAGAGGTGTTCTACAAGCAGCGTCGGGCCAATTTGTTCAGCACTGCTTCGTTTGTGCTGTCCAACT
CGGTAAGTCAGATCCCGGTTGCGGTGGCTGAAAGTCTGGTGTTCGGCTCCATCATTTACTGGATGTGTGGCTACGTGTCGACGGTGGGAGCTTACATCAT
GTTTGAGCTGATATTGTTCGTCACCAATCTTGCTTTTACGGCGTGGTTCTTCTTCCTGTCGTGTGCGTCGCCCAACTTGAACGTGGCCAACCCGATCTCC
ATGGTTTCCGTGCTCTTCTTCATCCTGTTCGCTGGTTTTACAATCACGAAAGACCAGATCCCCGATTACTTCATCTGGCTGTACTGGATCAACCCCATGG
CTTGGGGTGTCCGCGCACTTGCTGTGAACCAATACTCCGACTCAAAATTTGATACTTGTGTGTTCGACGGAGTCGACTATTGCGCCAACTACAACATGAC
CATGGGCGAGTACTCGCTGACCACGTTCGAGGTGCCGACTGAGAAATTCTGGTTGTGGTACGGGTTGGTGTTCATGGCAGCCTCGTATATCTTCTTCATG
TTCCTCTCCTACATCGCGCTGGAGTACCACCGGTTTGAGGCTCCAGAAAATATAACTCTGGACTCCAGCAACAAGGGCGAGGCCTCCGACAACTACGGCC
TGATGGGTACACCCAGAGGCTCACCAGCCGAGGATGATACCATCGTCTCCATCAGACCCGCAAAAGAAAAGCACTTCGTGCCGGTCACGGTGGCCTTCAA
GGACCTCTGGTACACCGTGCCGGACCCGTCAAACCCCAAGGACACCATCGACCTGCTCAAGGGGATCAGCGGATACGCGCTGCCCGGCACCATCACGGCG
CTCATGGGATCGTCGGGCGCCGGCAAGACTACGCTCATGGACGTGATCGCCGGACGCAAGACGGGCGGCAAGATCGCGGGCCAGATCCTGCTCAACGGCC
ACCCGGCCACCGACCTGGCCATCCGCCGATCCACGGGCTACTGCGAGCAGATGGACATCCACTCCGAGTCCG