Description :
From Genome Similarity Track
Location :
Scaffold_306:25885- 27556
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_306-snap-gene-0.19Novel protein
Pytap_DAOMBR444snap_masked-pag1_scaffold_306-abinit-gene-0.24Conserved gene of unknown function

Sequence
1671 bases(100 bases per row)
TCAAGcaaCTGCCATGCCAACAGCTTGGTGAAATCAGCTTTCACTTCACTCATCGTGTGGGGAAGACATTCAAGATACAGACGAAAGACCGTGAGTCCCC
TCATGTAAACCAAGGCCGCTTGGTCAGCAGCCGAACATAGCTTCAGCAGCAACGAAACAAGAGCTTCTGGGCTCGGAAGCTGGAATCGGAACTCATTCTC
GAGATCGGCTTGAGTGACTCCAACGGGAATATGTTGTCGCACAAACTCAAACCGACGGAGTGCACATTCAgTGAGGCCAAGAGACGAGTAAATCACCAAA
TTATTCGTgTGCTGGAGGCATCGTGAAAGCTCTTTTCGGGCACTCAGcGGCATGATTAGTCGAGACACGAGAATTTGAGCGGAGTATGCACCTGGAGCAT
CCGCACATTTCAGATCCAGCGTAGCCTGCTTCAACGGAGCGGAGAGTAGCCTATGCACCATGGATACGGTAGCAAACCATCGGTAGCCTTGCTTCGGCTC
CAGTTGCGGAGACAAGATGCTGAGAAACTCGGCTGCTAATCCAGGGAACTCCGTAATGAACGCAGCGACCAGATCACGCACGCACTCACTTCTGATGAAA
TCATTGAGGCCAATTGCGTTAATCACGCTACGGATAACTCGAATTGTCATAGTTGCGTTCGACGTCGGTGAATCGGCTGGATCGTTTGATTGCGCGTCTA
GCAGCGATGGATCTTGACCTACCTCGATCCAGTTGACTTCAAAATGAATGCTCGAACTGTTTGTCTGGGTGATATTTTATACAGTGCATTAGCTTCAAAA
AaCAACTTGCGCACAGTGGCCCATGCAACtGCCGCGACTTCTTCGTTTtCTGACTTGATTACTGATACCAAAAGCTGCACAGCAGAGCCATTGAAAATGG
CTAGACGGCCGCGCATATCCACGTTGGAGTTGTTGAGTACAAGTTCGTCGAGATGATTCGAGACAGTGGTCAGCATTTCGACATCATCTCCGTCGATACT
CTTGAGAACTGACGATACTAcGCCTCCGTCCTTCAACGCAAAACGGTGTACACTCcTATCAGGGCATGATGCAAGCGCGACAACAAGACGGACATAAGCA
GCACGAATCTGGAAGGCAGGCGCAGTCGTTCGGGAAGCATTGTTGTCTGCTTCCATATCTTGATCCTCGTCAGCGACCACAGCGGCTTTCTTCATTCGTC
GCGTTGCGAGCTTCGAGAACGACGGACCCTGGAAATTGAATATGCGGACAAACTCACGCGCAGAtACGACGCTAACTTGAACGATCACTGTCAAGAGTTC
CAGgACGCGGTACTCGATGATCGGCTTGTCGCTCCACGAtAACAACTTCTCCAGGTTGGCACTCTTCTCGCGAACAATCTTGAGCGCGATCGTTTCGGCG
GCATCTTTAAGCGTCTGCATCTTCAGCAACTTCGTCACGATCTCCAAGAAGACTGCAATACTCTCTCGGTCCTCCCACCGCGTGCCCTTGCCGTTCTCAT
CCGGCCAcACATGCACAAGCGGGTCTGCGTGAGCGCTGACGTCGAGCAGGGCCCTGAGCACGCGCTCGTCCTGCGCTGCGGCCTCGGCGAAGCGCTGGAT
CGCgCCATCCAGCGGCTGCTTGGCGCGCTCCGTCGCGAGGAGGAACTCGCGCAGCGTCGTCGTCGCCATTG