Description :
From Genome Similarity Track
Location :
scaffold_58:25884- 27544
Transcript NameFunction/comments
Pl_110881putative glycosyl transferase family 48 protein

Sequence
1660 bases(100 bases per row)
GTGACTGCTGGCGTAGAAGCGGTATAACTCGTCAAAAGACGAGTGCTTTGTCACGAATCCACGGCCCGTTGCACGGTACTTAGCGCCACCTGCTAGAATT
GTCTGTCCAAAGTAGAACCACTTCGTGCCAATGTGGAACAGGAAGTACAGCGGACCACCCGTGACAAAAAGGACAAGAATTTCGCTCAGTGCAGCCTTAA
AGCCACGCTCGACTGATATAGTTGCCAAAAGCGGCGCAGTCGTGAAGAACGCCACAGTTCCTAGCATCAGCTGCAAAGAGCTCAGCAATACCGGTTCACG
GCCTCCAACACCCTCCAACGAAAGCAACGCACGCAACAAGTTGCAGTACAACAAAAAATACACCGTCCAAATGATGATCGACGTCGACAGGTAGAAGCCC
ACATGGTTGTAGTAGAACGATAGCAGCTTGAAAAAATCGAGACGCTGGCTAATGCGATATACATCTCGCGACAGAGACTGCTCCGCAGCACCCTGTGCCA
GCTTGGCCTCAAATTTGTAAATCTGTTGCATACCAACATCACGTCCCTTGCCGCATTTTGAGTACTCGGGGAAAGTTACAGAACCGCCACGCATGCAGTT
GTTGTAGCCAGCAAAGATGTCTTCACTAAGGTTGATACCCTTGCTGGCCTTGCTGATACCACCACGTGTGATGAAGAAAAGCTTGTTAAATACATCAGGG
TGACCATAGTGCAAACGCATACGCAGTGGACGTGCCAGTGCTCGCTGACTCAACGTCACGAAGGATGTCTCCTGCAGCGCCATGTAGTTAGCCAGCGAAC
TCACGCTGCCTGTGAAAATATGCTCTGGTAGACCCACGATCGTGTACGGTCGGTCAGTCGTACCCTTATCAAACTCTTCGAGGAGGTTTCGCATCTTTAG
GTTCTCCTCGAGATATCCATCCTGGTTCATGTCAATTGTCTGCAGAGTTTCACCGCGAGTAAACACGATGGCCGCATTCTGGTTCTCAGGTTTACCCTCG
CCCAAGATTGGGTTGCCGGGCAGCCGCACACGGTAAATCTCATGCACAGACCCAAGATCCTCACCGCCCTTGATGAGCACTGAGAAGTATGACTGTTCCT
TCTGGTAGTTCACGCGCACCTCATCGATGTAAGCCACTCGTAGGTTCGGGAACCGATGCAGCAAAAATTCAATATCGCTTGCCTTCGGATCATTGTTCTT
CTTCTGACGTCCATAAATCTGGCAAGCAACGACGTATGTAAACTTGGTGTTAATCAAGTCCTCAAGCTTCTGCTGTGGAACTTGCTCGATCTCAGCAAGC
AGGCGAATGGCAGCTTCACCGTACATCATTCCCTGCACCGTACGCGAAAGTGTCTGGCCACGCAAAGAGGCCCACATACGCAACTCGATAGCAGTTTCCG
GGTTCTTCCAGATGTTCTTCTTCGGCTTCACTCGTTCCAAGAAGTTTTCCCAGTCTCGCTTGTACAATGTCTGCAAGAACAGTAATGTATGCACGTCTAA
GCCATCCTGTTTGCTTTCCAGGTCCTTCCTGGAATACAGGACGTCCTCAGCATAGAACGGGGTCATGACGCTCCACGACTTCATCTCCTCGAGTAAAGGC
GCCAGAGGCATGTCCATGAACAGCGAGTTCACAAAGAACAGCAAACGGCGACGCGCATCG