Description :
From Genome Similarity Track
Location :
contig_27:258836- 261008
Transcript NameFunction/comments
g7318.t1hypothetical protein

Sequence
2172 bases(100 bases per row)
CCTGGATCAGGCAAGTCGTCCCTCATGAAGCTGCTCAGCGGCCGCTTCCCAGACGGCAAGAACCTCACCAAGGAAGGAGAGGTGACGTACAACGGTATGC
CCGCCAACGAGCTGCTCCGACGTCTGCCGCAGTTCGTGTCGTATGTGACGCAGCGCGACAAGCATTACCCGTCGCTCAGTGTCAAGGAGACGCTCGTGTT
CGCGCACGCGTGCTGCGGTGGTGGCCTGTCAAAGCGTGAAGAGCAGCACTTCATCAACGGCACGCCCGAGGAGAACAAGGCCGCGCTCGACGCCGCCACA
GCCATGTTCAAGCACTACCCGGACATCGTCATCCAGCAGCTCGGACTCGACAACTGCCAGAACACCATCGTGGGCGACGCCATGACGCGCGGCGTGTCCG
GCGGCGAGCGCAAGCGCGTGACCACGGGCGAGATGGAGTTCGGCAACAAGTACGTCATGATGATGGACGAGATCAGCACGGGCCTCGACAGCGCCGCCAC
CTTCGACATCATCACCACGCAGCGCAGCATCGCCAAGCAGTTCCGCAAGACGGTCGTGATCTCGTTGCTGCAGCCTTCGCCCGAGGTGTTTGACCTGTTC
GACGACGTGGTGATCCTGAACGAGGGCCACGTCATGTACCATGGTCCGCGCGCTGAGGCTCTGAGCTACTTCGAGGGTCTGGGCTTTAAGTGTCCGCCTC
GCCGCGACGTGGCTGACTTTTTGCTGGACCTGGGCACTGACAAGCAGGCGCAGTACGAGGCGAGCTCGATTTCTTCTAAAGTCATTCCACGCGTGGCAAG
CCAGTATGCTGATGTGTTCAAGCGCTCTCGCATTTACTCAAAAATGATGGACGAACTGCACGGGCCAGTTGATCCGGCGTTGATTGAAGACAACCAAACG
CACATGCTTGCTGTGCCTGAGTTCCACCTTGGCTTTTTGGAGAGTACGATTGGTGTTGTCCGCCGTCAACTGACGTTGCTGTCACGTGATACAGCATTTT
TAATGGGAAGAACCATTATGGTGATCTTGATGGGGTTGCTGTACGCAAGCACCTTCTACCAGTTCGACGAGACTAACTCGCAACTGGTAATGGGCATCGT
TTTCAACGTTGTGATGTTCGTATCACTGGGGCAGCAAGCACAAATCCCCATGTTTATGGCGGCTCGAGAGGTGTTCTACAAGCAGCGTCGGGCCAATTTG
TTCAGCACTGCTTCGTTTGTGCTGTCCAACTCGGTAAGTCAGATCCCGGTTGCGGTGGCTGAAAGTCTGGTGTTCGGCTCCATCATTTACTGGATGTGTG
GCTACGTGTCGACGGTGGGAGCTTACATCATGTTTGAGCTGATATTGTTCGTCACCAATCTTGCTTTTACGGCGTGGTTCTTCTTCCTGTCGTGTGCGTC
GCCCAACTTGAACGTGGCCAACCCGATCTCCATGGTTTCCGTGCTCTTCTTCATCCTGTTCGCTGGTTTTACAATCACGAAAGACCAGATCCCCGATTAC
TTCATCTGGCTGTACTGGATCAACCCCATGGCTTGGGGTGTCCGCGCACTTGCTGTGAACCAATACTCCGACTCAAAATTTGATACTTGTGTGTTCGACG
GAGTCGACTATTGCGCCAACTACAACATGACCATGGGCGAGTACTCGCTGACCACGTTCGAGGTGCCGACTGAGAAATTCTGGTTGTGGTACGGGTTGGT
GTTCATGGCAGCCTCGTATATCTTCTTCATGTTCCTCTCCTACATCGCGCTGGAGTACCACCGGTTTGAGGCTCCAGAAAATATAACCCTGGACTCCAAC
AACAAGGGCGAGGCCTCCGACGACTACGGACTGATGGGTACACCCAGAGGCTCACCAGCCGAGGATGATACCATCGTCTCCATCAGACCCGCAAAAGAAA
AGCACTTCGTGCCGGTCACGGTGGCCTTCAAGGACCTCTGGTACACCGTGCCGGACCCGTCAAACCCCAAGGACACCATCGACCTGCTCAAGGGGATCAG
CGGATACGCGCTGCCCGGCACCATCACGGCGCTCATGGGATCGTCGGGCGCCGGCAAGACTACGCTCATGGACGTGATCGCCGGACGCAAGACGGGCGGC
AAGATCACGGGCCAGATCCTGCTCAACGGCCACCCGGCCACCGACCTGGCCATCCGCCGATCCACGGGCTAC