Description :
From Genome Similarity Track
Location :
contig_9:258832- 267336
Transcript NameFunction/comments
g2244.t1hypothetical protein

Sequence
8504 bases(100 bases per row)
AGTCGGATCCTTCTTGGGCATCCCGAAGATGTTGGATCCATGGAGAATCTGACACCTCGATCCAGTTCTTCTTCAGGAGCTCTGCCACAAAGATGTCCAG
CGCTTCCTGCTCGACCTTCGACAGACGAAATACTAGGCTTCGCCCTGGCTTCAGATGACTTCGTGCTCGATCGATCGTGCGGTGGTAAACCTGGTGGAAG
CTCTGCTGGAAAAACATCCGAGAATTCCTCTACCACTGCTTGAAGCTGCGGCGGAACGGTTTTCACCTTGGGGATGCCTTGACCGTGACATGATACAGCT
CGACGTACTCTCAGCCTTGACCTTCGTCGCGAACTGAGCGGCTGAAATGAACACAGCGAGGTGGCTGCTTTATCTCCGTCCTTGCCCGAGCCGTGAGGCG
ACGGCCGACAACCAAGTGACGCAATGGAGCTTGGACCCAATGCATATGAAAGTATCCTGCCTTGACGTGATCATTGAGCTGCTGGCGCAAGTTCGAGGGC
AGTGGATGCTGAAGAAGCTCCGACGTCACCTCCACCGCAGCCACTGTTGGAGGGGCTACGTCGAGGCTGTCGTTTATCGAGCGGGCATCCAGCACGAGAC
GCGGTCGTGGGATTCGCATCACACCAGTTTGCCAGCTGATGATCGGGTTGAACTGCACTAGCCAGGATGGCCGAGAATCACGACTTGTTCGACGATACCT
CCCACTCGAGGGAAACATCAGCGAATTCTCTGCCGTCAAAGCTCAGTGTCTCGCAGCAGCGGTGCCGTGCGGGCAGGAGTCGTAGTACCGTCGAAGTGCT
CCGCAGTCACTTTGGCCGCATCACGAAGTGTTGAGCGAGGCCAGGGCGCACGATGTTGCGTTCTGCTCCACTGTCGATCAAGACACGCACCACTTGGTCG
TTCATCATCCCTTCAAAGCGCGTAGCTCGCGTTTGGACGGAGCCGCTGTCAACGGACACCATGAGTTGTAAGCTGTCATGACTTCAACAAGGTTGTCGTT
GTCGTCAACAAAGTCCTCTTCGTCGTCGGAGTCGTCTTGGGCCTCGACCACGCAGCGGAACGAGTTCTGGTTCGCTCTGAACGAGCTGCGTCCGTGTGGT
GGCCGGGAAGGACCACGAGGGCTGTTGCGAGCCTGACGCTTGCGGCAGTCAGCTAGACGGTGACCAGGCTCCTTGCAGTAGAGACACAGGTTTCGCCGCA
TACACTCTTCACGGGAGATGATGCGAGCGTTGCCGATCTCCATTGGAGTTGGTTGCTCCTCATGCGCTGTCTGAGTTGCGGAGACGAGCGACGTTGCGAC
GACTGGTGTCCTGTTCGCAAGTGCCGTGAAGAGACGAAGTGGGTGCGGTCGTACATCAGCGCGAACGAGATTGCTTCGTGGTGGTCCTGAACTGCCTCAA
CTTCACCTCTTGTTTGATGTCAGTCAACAGACCCTTCTGGAAGTGCATCACCTTGTCGATGTCAGACATGTTTCCACCTTGCAGATGAGGCCTCGGAAAG
GCGACGTAGTCTTCGAGACACGAGAAGTTTCTCTGGCGCAGGCGAAGCAGCTGGTCGCGCAAGTGTTCTTGGCGATCCGGCGCTGTGAACTCGCTCGTCA
GAAGTTCTTCAAACTGCGTAACAGAGTGCAGAAGTGTCATCGTGGAAGACGTACTCACGATACCACGCCGCAGCAGGCCCTTTCAGGTTTGCTACCAAGA
GAGACAGCGGTCGCTGTTGAGGCGCTTCTGACCCATACTTGATGTTCTTCGACTCGAAGTAGAGCTTGGCGCTGAACATGTAGTCACCGACGTCGTCTTC
TTTGGTTCCCGAAACTTGGGCATGGTAATGCCCTCAGCTCGGTATTCTCGAGTGTCGACGGCAGGAGACTCACTCTGGCTGTTGTTGCTGCTGAGGTGGC
GCCTGTTGCTGCTGCAAGGTTGCTGCCATCTGACGCTGGGATCGGCCGTCTGCGCCATACACTGTTGCTGCTGCTCGTGCATCATTGCTGCAAGAGACGC
AAACAACTGCTGCATGCTGTCGCCGTGCTGCATGGGTTGTTCGTCCATGATTGCGCCTACGCTAGCACGTCGTCACTTAGATGACTGGGGCGCGCAAGCT
CCTCAGCCAAATCAATTAAAGTTGGAGCGAAGTCACAGACACTCCCTGGAGCGCTGCTTCCGTCAAGTCAGAGAAACCCAAAAGTTGGACGAAGTCACAC
GTTCACTGGAGCGCTGCTTCCGGCAAAGCCTGAGGAACCCAAAGCCGACGCTGTACCCTTTTCCTGGTACACCCCGAAACCCCAGTCCTCTCTTAAACGC
CCCTGGCGACGCCAACTAGGAAGACCGGGTGCGACCCTTGGTGAGAGCACACGCCGACTGAGTGTAGTCGCGAACAACTCGGAGCACCGGCGATGCTGAT
GGCGATTGGTCGTTACGGGCCAATTAGCGGTCGACACGAAAATGCGTGGACAGGCGGGTCTGCGCAGATGAATTCTCTCCCAGAAAAGAAAAAGCGGGCG
CGCGGAAGCAGACAGAGAACGAGCGGTCACACGCGCGGCTGAACGGACGAAAGGGCGTACAAGCGTGTGTACGGCTTAGGCGGAGGCGTGCTGGGCGACG
CGAGCTGAAGATCGACGGAGCGACTGGAACTGGACGGACGAGCGTGCGCTGCTACCAAAGTGTAAGGGATTGAAAACTGAATTGATCTTATGTGTGTGTG
CTATATGTCTACCTACGAGCGCGCTGGGAGTGCGCTCTTGAACATGCAGTGGTTGGCTATGGTTCGCCGTGGCGCGTGCTTGCGCAACCTTCGTGAGTAT
GCAGATGTCGATCTCGGCTCTCTGTGCGGACTCTCCTGGTGATGGCGTGTCGCTCTGCTTTTGTACTTGCAGATCGTTACAACCTTGCTGTGCCCATTTG
CTGTCGCCCCATCCGTCACTCAGCCGTGCATGCCTCTAACAGTGGTCTTACAACCACTTCACGACTTCGAGGTGGCCATCGCGTCATATCGAGACACTCC
AGTGGCTGCTGAACAAGATTTCGTCATGGAAGACAATGCTGGGGTTGAAGTGAAGGCAGCGGAAAAAGGGACATACTAATAATTGTCGCTCTTGCAAAAC
CTGCAATCTGTATACCAGCCCTGTCAAGGGTGTCGATTTGTTAACGCAAGCCTGCTCTTTGCATGCATGACAGCAGTTTTTGAGCACTTTCACAAGCAAA
CGGATTTGGCCAGCTTGCGCATTATATCTAACGAAAAAAGGACGCTTGTCAGGCAAAGTGGTTTTCTGATATAATTTTCCCGTGCAAAGTGGTTTATATC
AAAACTACTGTCCACCGACAAGTCGCTCAGCAGTCTGTCTTTCATGACGGCCATGGTCATGTCCGCCTGCTCGTCGAGGTACTCCTCGAGCTTGGACATG
ACCTCGACCGTCATCTTGATGCACGCAGTCCACACGCCGCCACGCGGCTGCTGCTCGATGCTGCCCTTAGCTGTGATGCGCCGCGCAGTAGTGACAGACA
CAGCATTGCTAGCCGCAACGCCCAGCCAATCATGGCTGCCAAAAACGCGTCGAGTACGCGCTTTTTCGCGCTGTTGCGCTCAAACTGCTTGGGGCGTGTC
TGGGCGTCGCAGACGTGGGCGGTGGGGTCATTGTTGGAGAGCGGCTTGGGGAGGCTTGGGGGGAGGATGTGAACACGCAAATGAAGGAGTGTCTGCATGG
AGACCATGGGCGGCTTCGCCAGTATCGAGTGGCTCACGTTGCTTCCACACCACTTTGGTTGGAAAAAATATGGCGCCAAACGCTTTGGCTGTAAAACCTT
ATTTTAGGTGAATTAATAAAACCTCGATTGACCGTTTTGCTTGTGAAAGTGTTCAACTTGACTGGTAGAAGGTGTAAATTGTAGCCTCTAATTCGCAGTA
GAAGCCGAGATATCGGCAACGATCCGCTCCGAAATTGGGGGTCCTATCGATTCGGCGCACGGTACACGGCTCTGCTAAAACGGTTGTTGAAGTCCCACGC
CGCACCGGTTTTGACGCTGGGTCCTCGTGGCATGGGGAGGAGGTATCGTGCAAAACCGTGGTGACCTGCGCACAACTGGGGTGTATCATTTGTACCCAAG
ACACAGGTGGTGTGGAGTTTGCAGGTTGTCTGTGGTCATTCAGCATTTGCCATTGCAACGATGGCATCTCCCCACCTCCACCTCCTACTCCGCTGGTAGC
TGCGTCGATTCTCACCAGTTCCAAGCGCGAGTTGTCATCGTTGTTCCACATCACTGAAAAGGTTTCTTCCTTCCTGGACACATCGGTGGAGCTTCCACTG
CATAAAGCCTGCACGTTCGGCTCTCTGAAGCTATTGAACCGCATCTGGAACAGTACAATCGACCTGGAGCACGAAACTGAGCCATTCTGGTCTGTTCGAA
GCTTTCTCCGCTCGGACAAGCACTACCAAGATTTCCAGTTCACGGCTTCGTTAGTCGAGGCAGTGAAGCAGAGGAATCTCGAGATGGTGCAGTGGCTCTT
TGAACATTTTCCCGAATGGGGTGTGGGTCGGGAAGTAGTTGAGGCGGCGGCAGAAGTTGGAGCTCTGAGTATCCTGCAGTTCTTCGCCAAAACGGCAGGA
ACCTCAATCCTCATGATGACGACGAAGAGGATGAGGATGAAAACAACAGAGAGCAGCGAGGCATCGACTGGGGCTACGAGGATGCGACCAAAGCGGCCGT
GGCTGGTCATAGAGACGTCGTTATGTGGCTTTATCAATACGCTGGAAGCTACACGAGAGATGATCAGAAGACAACGTTGGCTGTTATTGCCAGTGGAGAT
GTGGATTTGATCCAATGGCTCTGGGAACGGCTCGACATGCCGCCTGGTAATGGAATGCGTGAAGCAGCAGCGAACGGGCACATTGAAATGCTGGAGCTGT
TGGAATTTCAGGGCTACGGCGGCATTGACGTTGGGCAGCTCGTGAAAACTGCTGAGGCTGGCCAATTGAATGCTGTTCGATGGACTATCCGAGATTTGGA
TAGACAAGATCGCAATTACCGTGATTGGGGGACTACGGATTCGCTCTGAGATCCGATTCAAATAGTGGACGCGTTGAAATTACCCGCCTCGGTTGGGAAG
CGGGGCTTGCCATTCACGCTGCTGCAGTGAATGGACACCTGGACGTTGCGAAGTACCTCTACGATCGCATCGACATTCGACTTGATTTTGACGACAAAGT
GCAAGGCGGCAGAGGTCCGAACACCTGGATGAAGGTGTTGAAAAAATTGGAACTTAGATCTGAAACCAATTTATCAACAGTCTCAAGAGATACGATGGTG
CTTGCTGCGGAGCGAGGCTTTCTCGATGTTGTCCAGTGGCTATGGGCAGAATTTGGTGATGACCCAACGATGAATCTCTTGTCTGCGTGCACAAACGAGC
AATCGAGGTACGATTGTGCACTTGACGCAGCTGCTGCTACTGGGCACTTGGCGATTGTTCAGTTCCTGCATCAAATTGGCCAAGATCCAGTCCTCGAAGA
CACCCGCAACCTGAAACGCAGACGGCTGCTCAAGTTCCCAGAACTGTGCTGCCATGGAGATCCAGGTTCCAGCTCTGCACAGCCATTGGGGCCTTCCCCA
CCAGGGACGCCAACCTGCACGGTGGCAGCAATGGATCTCGCTGCAGCCCATGGCCACCTAGACGTCGTTCGGTGGCTTCACCATAACCGGACGGAGGGCT
GTACTACAGACGCCATGGACTATGCTGCACGAAATGGTCACTTGAACGTGGTGCAGTGGCTCCACCAACATCGCGGAGAAGGATGCACTCCGAAGGCAAT
GGACGGAGCGGCGACTAACGGCCATCTGGATCTAGTGAAATGGTTGCACGGTCACAGAACGGAAGGATGTACTGCGGCGGCAATGGATGGAGCAGCTAGC
AATGGGCATCTTGATGTCGTACAGTGGCTCCACTGCAACAAGTCTGAAGGTTGTACGACTGCTGCAATGGACGGCGCCGCTGCTTGCGGGGCACTTGATG
TTGTAAGGTGGCTGCATCATACCCGCAGTGAGGGCTGCACGACAGCAGCGATGGACGGCGCTGCTGGGAACGGCCATCTTCGCGTTGTTCGGTGGTTGTA
TGACAATCGCGACGAATGGTACTCAGTAGCAGGAATGGACCAGGCACTTCAAAGGTCCGAGTTTGAATGCTTGGCACTACTGGACAAGATAAAGCGAGGA
AGTTTCACCGCCTTGCGAGGTGTGGGGACTCAGGCGTTCGTAGATGGCTTCTTGAGCGGTACCCCGAATACAGGTCTTGGTATTATTGATAAGCTGGCCA
AGAGTTCAGATGGCTGCACGACCAGCGAAAGTTGTACGACAAGTGATGACAATGTCATCTTGAATTTCAAATTCGACTTGCTCTCCCTAAAACGGTTGGA
TCTTTGAGCGTAGTCAACATTGAGCAAATGCAACCATCGACTATTATTAAGATTGAAATCGAGCTGCCTTTGATCAATGAACCGTTCCGAAGGCTGGACA
CCCACGCATAGGAAACGTTGCAGGCATTTCGAATCGTGTTGCTATTGCACAAAATAAGAGACGAAGGCTGCGCGATCGAGCTGGGAACAGATGAGCTTCG
GATCTGAGATCCCAAGTGGTTGATGAGTCACATCTAGTGCCGTACGAGCTATCGTTTTCATGAAACAATTGCACAAAGACTTCCTCTACGAATGCATTTG
AAATATGTATGGATTCGATTGGTGTGCGACACACATATTTGCCAACAATCAATCCTGCCAGAAAAAGTCGAGATGAACTCGTAGACCAGCGCTGCTCATT
GTCGTGAAGCTGCTGTTCCGCGCCAAGGGCGAGTTCTTGAACCTTCCCCACGTTGTGGCTGCAGTCTCTACGTTCCTGGACTCTGCGATGGAACTCCTCT
GAACGAGGCGTGCAAGCGGAATTCAATCCAGCTGCTGAGTCGGATTTGGGCCAGCAGCGAGATTTTCACCGTTCGCAACGAGAATATGGCGCAACTCTCC
TGGACGTTACGGAGACTTGTTCGCACGGATAAATACTACCGACAGTATCAGTTCTCACTGTCGCTGGGAAGCTATTCGCCTACACAATCTAGAGATGGTC
AAGTGGCTCGCTTCTAGGTTCCAAGGCTGCATGGTGCGTGAAATATTGTGAGTCAAGCAGTTGCAACGGGGTCCATCCCGTTGCTGAAGTTTGCTTGAAA
GTGGCAATAGTTCAGTGAATCCAAGTGTTCAAGCTACAGACGTGGGTATTCGTGTTCAGTGGAGCGAGAAAAATCTCTCTGACGCAGCGTCAAGTCGGCG
TAGTGACGTCGTGTGGTGGTTGCTTGAGCACTTTTCAGATGAAAGTCACGACAAAGACAGATCTCTGCAGATTGCAGTGAATAATGGTGCCGTGCCATTG
GCTGATTGGTTACTCCAGCAAGGTGCAAGATGGCCGAGAAATACACAAGGCCTGCAATTGGCGCACTCTGCGGCAGCTCAAGGACGTATCGATGTGCTCA
AATGGCTGGCGAAGCAAGGTCACGTGGAGGGGCTTATTGGACTGGTGGTGATAGCTGCAGATAAAGGAGAACTCGATGTTGTCCAATGAGTGATCAATCG
CGATACACGAAAGAGTGGCGGTACATATCTCACTGACTAGGGTGGGGAAATTAGCCTCTTCATTCATAGTGCTGCAGTGGCAGGCCATTAGAAGTTGCAA
AGTATCTTCGAGCACGCACGAAAAGCCGACGGACAGCTTACAGCGCGCAGTGGAGCAGGCAAAACAACGTCTCCAAAAATTGTCTATGTACCTCAGTTAC
TACGACAATTCTGGAATAGTACCAGGGAAAACGATGGCGGATGCAGCGGAGAAGGGTCGTCTCGACGTGGTTCAATGGTTGTACGCAGACTACGGCGAAG
ATCTTCATACTGATATGGTGAAGCGAACATGTGAGATATTTCGATCGCGATGGATGCGGCTGCAAGCAGTGGACATCTTGATGTGATGAAATATCCGAAT
CAACTATATTTTGATTTAAACGAAGGGTAAATGAAATGATTGCGAAAAGGGATCCAGTCCAAAAAGCACGACGGCAGCAATGCATCTGATAGCTGAGCAT
GGTTACCTGCAAGTTGTAAAGTGGCATTTCCTTACAACAGAAAGGAAGGCTGTACAACGAGTGCAGTGGATGCTGCGGCAAGACGTGGTAAGTTATAGTG
GCTTCATGAGCACCGCTTCGAAGGATGGCAGTAGCAACGGGAGCAGCGATGGATGGTGCGGCAGAGCATGACTCTCTGAAACTGGTAAAGTGGCTCCATG
AAAACACCAGCGCTGGTAGTACGACCAAAGCATTCGACCAAGTTGCCAATTTCGGGCATTTTGGCGTAATGCAATGGTTGCATTTGAACAGGTCAGAGGG
TGTACACCGGATGCAATGGACGGAGCTGCTGAGAACGGCATTTGGAGATTGTAGAATGGTAATCAGAATCGGGTCGAGATGTGCACGCAGCGAGCCATGA
TCAA