Description :
From Genome Similarity Track
Location :
Scaffold_3:2587983- 2591862
Sequence
3879 bases(100 bases per row)
CACTTCCTCGACCTTGGTGTAAGGTACACCAATGGCTACATACATTTACGACCACCACGACGGGTGGTCCATACACATTTAGGATTCCTATTGGCTGAAA
GCAGCATCTTTTAGCCAATGAGTGACTTGGATGTTAGCAGAATCCTGCCAACCAGCCGTTGGCAGATTCCTAGTTTAGAATATTACATTTAGAGGAAGTC
AGAAACATAAAACAGAAATAGCAGTTCTCATTTTAACCCAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAA
CTCTAGTGTAAACTACGCTACGCTGCCTCACACACGTGCGCGCACGTGTAAGCTAAAGTAGTGAGCCAAACTAGGCCCATTACACCTGGTAGCACTTTGT
AGTCCGTCCAACGACCGACTACCTGAACGTTCGTACGGAGCTGTACGAACGAGGAGCCGAGAACCTTTTCATGAGCACGGAGGTGCCCATGGAAAGCTCC
ACTTCGCCTGCAACTCATGTTGCACGCGCTAACTACCTCCACCTGTCGGATCCAGAGTGGGAGGCACTCCAACGACTGTCAACAGTCTTTGGGGAGGCGG
CAGTAGCTGCGATGCTGCGTACGCTATCACCGACAGAGCAACATGTTGTTGCTCTGGGGTTCATCATGAAGGAGCAGCGTGATGCTGCTTCCTCTACCAC
GGTGGCGTCGGAGACGACACCGCGTGGACAATCGTTGAAGCTAAACGTGAGCAACTATGTCGGAAGAGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCGAA
CTCGACACTGCCATCGCGGCTCGACGTATCGTCGCCCCGTTTTCCAAGGTTGCGTTCGCCATGTCATGCCTTGGCGGACGAGCGATAAGTTGGGCGTATG
GGCGCCGACTCTCTGATTCTACGTGCTTCAGCACGTACGAGGGTTTCAGGGAGAAGCTCAGGCAAGCGTTTGAGCCCCCGCAAAATGAGTTTCGGTCGAG
GGCAGAGTTCCTCGACCTACAGCAGGGGAAGCATGATGTTCATGCTTACGCGCAGAGAGCACGGTATTTGATCTCGAACATTGTGACCAACCCGATAGAC
GAGGCGACCAAGGTCGTCACGTTCATGAAAGGACTTAGAGATGGGTCTATGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTA
CTCTTGCAATGCAGGAGGAGTTTAGCCTGCGACAGGCTAAGCTGCATGCAAATGCGCCGAGGCAGCGACCGCCTCCGGTTGCGATAGCGGGAGGTCCGGA
ACCAATGGACCTCTCGAATGCAACCGCTGCTGATTATCAACAGCAACAAGGAAGTAATGTACGATGCTTCCGTTGCGGAAGGATCGGTCACTATGCCCGA
GAGTGCACGGCACCCGTGCACCGAGATGGTGGTCGACGCGGCGATGCCGGGCACCGCCGCAACCAAATAAAAAACGCTGGACGCCAGTAGGCGCGGGGCG
CCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCAACACTGAGGACTGCAGCCCCCAGTGAGGTTCATTCTCACTGCAAGAACCAAGATGAC
AAGCCTGACCTTGTCATTCTGAATGTGAACTCGATGAGAGCAAGCGACTCTCTTCGTGCTTTAGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACTGC
GAAGTCTATCAAGGCTTGACTTCGAGAATTGAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGATGCCGTCGTGAAGACCGAGAAGCGCAT
GGAACGCGTGCGCTTCACGTATCAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGCATGCCGTGG
CTTGCACGGCATGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTAGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTGCGC
ACGCACGGACAGGTGCGCGCGACTCCCCACTCGAGACAGCGCCTAATGCTGCTGTCCCGAAGCGCCCTGGGCGCGCGCGAGTACGCGCGCAAGAGCAGCA
AGCGTCGGCGTCGCCGCCGATGGCTGAAGGAGAAAATGTGTTGATCTCGGAGATCGACACCCGCTTTTCAGCGAATCAGGAAGAGTCTCCGAGCTCAAGG
GGCACGGATGACGCAAGCGAGTCACACGCCTCAGCCGTGGAGGCTGACGTGAATCTGATTGGATCAGTTTTGGCCAATAATAAGAGCCAAGGTGACGAAG
CGCCGTCGACTGCGGGAGTCGATGGATTGGCTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGGGGTCTCCACCAATGGTTGGCG
TCGAGGTATTAAAGTCGGGCCGGTTCCGGGAACCGGCGCTGCGAAAAGGAATTTCGCGTCGACTCCGGGAGTCGACGCACCCCTTGTAATAAAGGTCTCC
GTCAATAACAGGCGGCGAGGTAAAGATGGCGTGTCGACTCCGGGAGTCGACACTGCAAGCGGTGCGGATGGTTGCAAACATCCCGCACCGGAAAAACTTG
GATGCTGTCATGCAGCCGGGCTGCACGACGAAGCACCGGGTGACCAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATGAACCCGCCGGCGGTACTAAAGA
AGATCACCCGTCCACGGCTGGGCCTGGACGAGGTCAAGAACCAAGCGGAGCCGGGCTCCGCAAAACAAGAAGACGGCGCATGCGAAGATCGCTGCGCAAG
TCTCGGCCTGGGGCCGAGACGCTACAAGGAATGTCTGCCGGGCAGACGGAGGCTGAGAAGCCGGACGTCGAGATGTTGAACGTCTTGACGCGTACCTGTG
CCGGGTTCCGGTACGGGGAGATGACTCTCGCTAACCCTCCGACGCAAGCGTCGGAGCTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGA
CTTGCACGATGGACGCATCGAGCAAATATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTTATGGAGAGCACC
ACTGAGAGCGAGGACACTCTCAGTGCGAAGACGAAGAAGGAGCGCTTTGAAGAGCAGAGCTGGGACTCGTCTTCAACGAGTCCCTACTACGAGATTCTAC
GGGAGTACGCGGACGGGCTTCCGGAAGAGATCCTGCGGAGCTTCTGCAGGACAAGGGAATCCAGCACGAGATGGATCTCGTGCCGGGAACGAAGTACTGT
GTCACACGGCAGTGGCCAGCAAGTCAAAGCGATCGACGACTTCTTCGAAAGTCGTCGCATAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCT
CCGACGTTCTGTGTCAAGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGATACCGGCGCAGACACCGATACCTC
GAAATGATGTCATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGAGCGATGGATTCTATCAGATCCTCATGCGTGAGAGCGATAT
CCCTCTCACGGCTGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCAGCAGGGTCTGAAGAACGCCCCTGCGACCTTCAAAAGGTGCGTG
ACGCACTTGCTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGC
ACAAGGTGCATCTCCGGAAGCTGCTTGCGCTTATGCGCAAGCACAAGCTCTATGCACTCGCGAAGTTCCGAGTGTATCT