Description :
From Genome Similarity Track
Location :
Scaffold_27:258732- 261129
Transcript NameFunction/comments
Physo_133657hypothetical protein
Physo_133658hypothetical protein

Sequence
2397 bases(100 bases per row)
GACACGCCGCCGAGCATCCGCCGACAGTATGCGAGTCCGCCACGCGAGTCGCCCGATCAGCGGCGGCGACGTCTGGCCAACCGGCGTGCAGCCAAGTACC
GCCACTTCCGGGCTCAAAACGCAGCGGACCCGGTGGCTGAGCGCCAGCGCCTGCAGAACACGCGACGGCAGCGCGAACGTCGTTCGCAGCTGGACGCCGA
GGCGCGCGAACGCCTGCGCGCGCAGAACCGGCGTCGGCAGCAGCAGCGCCGCCAGGGACTGAGCGACCGCGCCAAGGCGGAGATCCGCCAGAAGCAGCGC
GAGCGGCAGCGTGAGCGCCGCCAGACGCTGGACGATGAGGCGCGCGAGGAGCTGCGGGAGCGTGAGCGGCTGCGCATCCGCCGGCGGCGGCGTGAGCTCA
AGCAGCAACAGGAAGAGGAGCAGGACCAGGCGGAGGCTGCGCTGCCTGCCTCCGCGCGCCAGCTTCAGCTGCCGCCAAGTCTGGGGAGAGAGCGGCTGCC
GCAGCTGAGACTCGCGCCGGAGCTGCCGACGCTGAGGCAGCACCAGGAGCAGCAGAGACACAGAGAGATACAGAGCAGGCTGCCGTTTGTCGGCGGCGTG
CAGTTCACGCTGCCGCCCCCGCCGGCGCCTCTGGACATGGTCCGGACCTTTGCGCACGAGCGGATCCCCTCCTTGCCGCACCTGCAGCAGGTGACGAGGC
CGACCACGTCGCTGCTACACTCGACACCGCCGCCTCTGTTCCCGATGCCGGGACCACTTGCGACGACAAGTGGAGGACCAGGAAGTGCCACGTCGGCTGG
ATTGCCGACTGTGGCTAGTGCAGTGGCGGCGGCGGCGACCAGGCCTCCGCATCCGACCCCCATCATGCCGTCCGTGAGTTTGCCGCTGCCGAGTAAGCCG
CTGGCCGCTCTGCCCATGGTACCTCAGCAGCAGCAACAACAACCACCAAGGACGCCTATTGTGCTCCCACCAGCACATCGCTCGCTTCCACCGCTGCCCG
ATTTCCTCAACAGTAGAGAGGCATTCAACCCAGCTACAGCTGCAGCTGCGGCTACTACAGCGCGCTCGACGCGGCCTTCCAGCAGCGCTAGCAGAGCGTT
GTTCCCGTCATTCACTGATCTACCGGCTACGCACACGGAGGCACAAGAGGCGGACTCTTTTTTCCAACGATGAGAGGTCTTCGAACGCAGACAAAGAGGG
GGGAGGGATGAAATGCAATACTTGCATTGGGTTTGATACGCCGGTCTGTCCTATCGTGCTATCATGAGTTATCGTCGATCTATCGCAGTAGGCTGTCGAG
CTTGTTGACGCTCCCCTTGGCGAGTGGGCGATGAGGGGCATTGATGTGCCAGAGCGCTCGAAAAGCCTCATGCGTGTACGCGCCGCGGTTTGCCAGCAGA
AACATTTCAAGCTGCGTCTCGGACAAGTTGAGGAGCTGGTAGTACCGCTTGGCGTGCTCCAATCGCGAGGCTGACGAGCAGGACGAAGGCATCGAAGCCG
ACGAAGACAAGGACAGACCATCGCGTGGGTACGAGTAGAGCGTTCCTGTGAGTCCTTGACGCAGAGCACCGATGTTGAGCAGCATTTGCTGGACACCTCC
GCGAGTAAACGTGCAGTCGGTCATCTGTGCGAGGTTGCCTATCAGTAGCCGCGATAGTAGCGCGTCCACGCCATTGTACACAAGCGTCATCTTGTCGCTC
GCCAGGTATGGCTGGAGCGCGTTTTCGATCGAAGAGAGGTTGAGGTTGAGCGTGAGGACGCTGTCTTGAGCCATGGTCGGCTGGCCTTCTTCTATGTCAA
ATCGCTGCGAGACGAGCTGCGTGAGGTAGTAGCAGCAATGCAGCCTCACTTCGCGGCGCAGGAAAAGAAGACACGCATCAGCCAGGGCGCTGCATTGCCA
ACTCGCCGCTTGAAGCGCCATGGTGAGGGCTGGCGAGGTAACAGGCGAAGTCGGACAATTGTTGGACTTCCCTTCGGAACCTCCAGCAACACGTTGAAGG
TACACAGCGATGAGGTCGCATGCGCTGTTGGCGTAGCCGAGCATGCCGATCCGCGCGTTATCCATCAGTAAACCGTCTGCTCCGTGCATCCACGCATCCG
GGTCGTAGAGTTCGCTCTCGAGCCCAAGTTCTCTTGCCGCTATGACCTCCTCGGCAGTGATTCGGGCACCTGCACCACTAGTCATGGATCCGGTCGGCTG
CACCTTCGAGTGGTGATACGGGATCGGGCTCCCTTGCTTGGCTCGCTGATAGCCTTCGTAATCGTGGAAAATTGCTGCCAAGTCGGCGTACGTGACATTT
TTGGTCTGCAGTTGCTGGTGATTGAGTGTTTGCTCTCGGATATCCCGCACAATGACGGCGCATTCCTCCAGCCAGCTCAAGACAGAGGCTTCCAGCA