Description :
From Genome Similarity Track
Location :
Scaffold_58:258711- 266589
Transcript NameFunction/comments
Phyin_T30-4PITG_17514Putative uncharacterized protein
Phyin_T30-4PITG_17515Glutathione S-transferase C-terminal domain-containing protein%2C putative
Phyin_T30-4PITG_17516S-adenosylmethionine synthase
Phyin_T30-4PITG_17517Crinkler (CRN) family protein%2C putative

Sequence
7878 bases(100 bases per row)
ACTCACAGTGCCGGTACCGTGCAGGTGGTGGACGTGGCCAATATTGCCGCCAGCTACGAGCATCGCACTGAGTTCTCGACTGCTGGCGCAGCACGCACAC
TCAAAGTCGGCCTGACAGATGGCCACCAATTGGTATTCGGCTTCGAGTATATTTCCCTGCCACAGTTTAGTGTGAACGTGCCGCGCGGGACCAAAATTGT
GGTGGAGAATGTGCCAGTGAGGCATGGATTGCTTCTGTTGGGACCTGAAAATTGCCAGTTATTGGAGACGTCGGCAGATTATTCGGGACGTAGCAATGAA
CAAGTGCAGCAACCTATCCAAGAGAATGGCTTGAGTGCTGGAGCGTACTCTTCAGCTCTGGTGACGTCACAATTCACTTCGTCAGAGCAGAAACAACCCG
TAGCTCCACGTCCGGCTCGACAGCAGTCGGTCGCTAGACCTCCGACAATAGCTGCAACGCCCAGCAACATTCCTCGGACTGCTAGCACTATTCCTCTGGT
ATCTATGAGCGCAAACTACCAGGCAACAGCGTCGACCGTCGCTACCAGCAGTTCAGTCCCGTCCGTGTTTGTAGATGCCCCTTCGTCAGATGAAGGCATG
GATAGCGACACCACAGACCCAATGGTAGAGCACCTCTTCTACAGCCCGAAGACTCCTCGATATCCTGCTGGTACGGAGAAGGCTAAGGCACCTCAAAACA
GGGTAATGCCTTCCAGGAAGCGGCCGCGATCACCGTCAATGGAGCAAACTATAGGGAGAAACGCATCCAATAGGTCTCAAACTCAGCAAATGTCGACGTC
TGCACGGACAATAAGCACTGCTCACGTTGCGGTAGTGGAGACTACTTCAAGGTTTTCACTGCTGGGTGAAAACAAGATAAACAACATGATGGCTGGGTCA
GCTCCGCTGTTGAATCCAACACGCCCGTTCCAGTACTTCACAGCGCGCTCGCCAGCATTGACAGCACTGAATCAGACGACAACAACGATTAGATTCCAGA
TCCGTGCTTGTATCAAGTCGGTAGTAGGTTTCCAATTTAACACTGGGAAGTACCAGCTTCGAGTTTCCGTGGAGGATTGCACTGCTACGAGAGAAGCTGA
CGTGGCTGAAGATTTCGTGACGCGCCTCATGGGGGTTCCGTGCTCGGAATTTCTTCAAACAATGCAAACGAAGGTCCAAGTTGCTCACAAATGGGCGGCC
AGTATGCAGTTCGCGCTAATGAACTTGGAAGGGGTCATGACTTTTGAGAAAGCGCCATCCAGCTCAGCTCCTTTAATGTTGATAGATTGCCGTGATTTCC
AGTCATCTGATACGCGGGAGCTGTTGCAGCGAGTGAGAGCGTCGTTGCCGCGATAATGACCCCTTTAATCTAACATACCAAGCCACGTCAAGGCAAAACG
TACAGTCTATTATTTGTCTATGCGCCGAGCATTGCTTTGCGTACCAGTGCGTCCGTCGATAGAACAGCCTCGCACTCGAGTTGGAACAGTCTGTCGCCTT
GCTCGGCCGTGAGATTTCGTGGTATTCCCACCAGTACGTCGTTCTTTGGCGTGGCAGTAGGCGGGTACATAACAAACATGGACGTGTCGTACTGCGCCTC
CTCTGCACGCATGTTGCGATCACTCTCAAGGAGCGTCTTGCAGCGTCGACGTCTACGATTAATGTCGCTGTGCGCCACAGTAGTGTTGCTCGAGTGACCG
AAGTCTGCAGCCTTCGCTAGCACTTCGTACTCGGTGCGTGAGAGCTCAGCAGCCAAGGCGGCAGAACGAGGGTAAGACAGCTCGCTTAGCTTGATTTTGC
CGACACAACACGGAGCTAGCACGTAGGCGGCTCGTTCCGCGAGGCATTTCTGCATCACCATATCGGTGGCCTCCCCGCAAGCGTGGAGTGCAATACCCAC
ATCGAACGGCTTATGATAGTCATCGATGAAGCCGCAGAAAATCTCCACGTTGGTCAACTGGGCAGCAGCAATACGCTCCTTAGCTACGTGACAAAGCATG
TCAGCGAGTTAAAAAGCGTTGAATACATCCATTTAGTCATACCGATTGCAAGTGAAGGCTCCTTCTTGTCAAGCAGGACAAATTTGCACTGTGGAAAGAG
ACAAGCAAGCGGTAGTGCCACGTATCCAGACCCTGCGCAGAACTCCACAACCACATCGCCTGGCCTGGAACAGGAAATTAAAGCATTATTAGCCTTTCCA
GCACATAGCAGCAACCCCCCACGGTATGACAAACCTCAAAATGCGTCGCAAGAAAACTGCGAGGTTGTCCACTTGCTGTCTCTTGTTCCTTGCTCGCTCT
GCTGGCAGTTTGCCATCTTGCGGGTGGATTCCGTCCGGTAGATCCGCCCAGGGGATGCCCTCTTGTTGTATCTCAATACAAGTCTTTTCCGATATGTGCA
GACACTTGAGTGGGTTGCAGTGATAGCAGGATTTACTGCAGCCGAACGATGTGCCCTCTACGCGTTCCAGTAGCTCCTCGAACCAAAGCTGCGAGTTTTT
GGGCGCCTGCAGCCCCTTTCTACGCAGTTTGCGAATACTTCGCTGTCTCTGGGATGATTCCACGAGGTCAAAAGTTTTAGACGTAGCAGTGGCGATAAAG
GCTGGTGTTGCATCTTTTGTGAGGCCCCATTCAGAGTCATCCCAGGTGCCCCACGTCAACGTCGACAGTACGCTGTTCATGGCTGTACTTGTTTTGGTAC
TTTGAACCAATCAAACTAGATTATATTATATCAGTGCATGAGCCTACTGAATGCGCTGAGAGTATACGACACCGTATACACATTGTGTATATCGTATCGT
CCTAAACAAACTAAGCGCCATTCTTTTGCTACTACGTCTTTGTCCACACACCAGCTCTTACTAGCCTCTGCACCCTATGCAGTCTATCATTCAATACCTG
GTACAGCATACTTGATTGAACCCACTGGCGAATGTCAATTAAAACTAGCTAGTAGACTAAAGCTATCCGTTTTAATACCCGGATTGCTAATTGCTACCGT
ATTTAATAGTGCAGTCACAACCGACCTTCTCAAGTAGCTGTCTGTCGTTTTTCACATACACGATGATGAAAAACAGGAGCGCCTAGAGTTAGGCTTAGAG
TGGTGTACAGTACGCGCAGTCGACGGTCGTTTCAGTAGCAATACTGTACATATAATATTCGCTTAACTCCCTTACAGCAACTGCAGATTTGAGAGTTAAG
CTACAACCCAAATTATCGAAGATCAAAAAGAGCACCATGGATAGTTTGAGTCTGCAACTTGCTGTCATCGTGTTTGCATTCAATTGGCTAGAAATATGTC
GTGTTCAATGTGGAACAGCGTGTTCTGGTCGATTGGTCGAAAAAAAGATCATCACTTATCTTTTAGAATTCATTCCCCGCATAAAACGTTTGGCTACCTT
CGGCGTTCCCAGTAGAATTTCCATTGGATTATCAAGGTAGATGGGTGACGCACCTGAGATTGAAAATGGGTGGTGCTAAGCAAGCAAGTCCGGTGTAGCG
GTCGACGCTGACATGCCACGCGTACACCCGCAGCGCTCGGTGGAGCAAGATTTCATTAGCACGAACACCACCCCCGTACGCCAGCGTTATTATGAGATCG
CGAGGTCTCGAGGATGACGACACGGGCAGAGCGAATGTACATGTTCGTCTCCTGACCAGACGCTACGTGCTCGTATGATTGGTCCAGGCGGCGGAACGCG
GCACGTCGATTGGTTGAAAGCTCATCGCGCTGGGCCCACCACTCACCTGCATTCTTCGACCAAGGTTTTTCACCTTCAAGCCCCGAGGTTTTTACGCTTT
AAACCGATGCCATGCTGCGCCATCCATGGCGGCGCCCATTCTGGAATCTGCTTGCCGGCGCCCACATTCATTCTGCACTTTAAGAACTCCTTCAATCCTT
AAAGATGACCCAGACCACCACCAAGGACCGTACCTTCCTGTTCACGTCCGAGTCCGTGAACGAGGGCCACCCGGACAAGCTCTGTGACCAGATCTCCGAC
GCCGTGCTGGATGCCTGCGTGTCGGAGGACCCCAACTCGCGCGTTGCCTGCGAGACGTGCGCTAAGACTGGCATGGTCATGATCTTCGGCGAGATCAGCA
CCAAGGCTATCGTCAACTACGAGAAGGTCATCCGTGACACCATCAAGGAGATCGGCTACGACGACCCTGCCAAGGGCCTTGACTACAAGACGGTCAACGT
CATTGTGGCCATTGAGCAGCAGTCGCCTGACATCGCCCAATCTGTGGACTCCGTCACGGACGAGGACGTCGGCGCTGGTGACCAGGGTATCATGTTCGGC
TACGCCTCGGACGAGACGCCCGAGCTCATGCCGCTGTCGCACGTGCTTGCTACCAAGCTTGGCTCCAAGCTGACAGAAGTGCGTAAGAATGGCACCCTTG
ACTGGATTCGCCCCGACGGTAAGACCCAGGTCACTGTGGAGTACAAGCAGGAGGACGGCCGCATGGTGCCCCAGCGCGTGCACACCGTAGTCATCTCTAC
CCAGCACAACGACGACGTGACCAACGAGCAGATCGCCGCGGATCTGATGAAGCACGTCATCCAGACCGTTATCCCGGAGAAGTACCTTGACGACAAGACA
GTGTACCACTTGAACCCCTCTGGACGCTTCGTCATTGGTGGACCGCACGGTGATGCCGGTCTGACTGGCCGTAAGATCATCATCGACACGTACGGCGGCT
GGGGCGCTCACGGTGGAGGTGCCTTCTCCGGCAAGGACACGACTAAGGTTGACCGCTCTGCTGCCTACGCTGCGCGTTGGGTTGCCAAGTCTGTGGTGGC
CAAGGGTCTTGCCCACCGTCTCCTTGTGCAGCTCTCGTACGCCATCGGTGTGCCCTACCCGCTGTCGATCCACGTCGACTCGTACGGCACGGTGAAGGAA
GGTGTGACTGACGACGACCTGGTTGAGATCATCAAGAAGAACTTCGACCTGCGTCCGGGTATGATCCAGAAGACCCTGCAGCTGAAGCGCCCGGTGATGC
AGAAGACCGCTGCCTACGGCCACTTCGGCCGTGAGGACGCGGACTTCACGTGGGAAACGGTGAAGGAGCTCGAGCTGTAAGGTGCTGGGAGCCGGATGAT
GTGTATATTGTCTGCTGCTTATTATTTGCCCAGTACTTAGCCGCTACGAGAAGATCACTCCGCCGTCAGCTTTCCAGCGATGGAGAGTGGGGTGGAATCG
GCTCTGCTGTGATCGGTCCCTGTGCTGTCCTGTGAGAAGAACTGCACACTTGACTCCTGCTGTCAAGTGTCCATTCTTTTTGCGGGTAATGCACTGCGGA
TATGAGCAGTCTGCCCATTCCACTGTCTCACAAGTTTTCGTGTTTTAAGTTTTAGGAAATGGTTAAAACGTCGAAATGAAATAGGTTAGCGCACAGTCTT
GTTTTATTGGAGCACAATTACGTTAGGCTTTTCAAGCAAATCTCTTGCAAGGCCATGAGCTTGACACTAGTGCAAGGCGCACGGACTTGTCTTACGGGGT
TAATGCTGTTCTATTCTCTTCGATGATCAAGTTGATCACCTCGTTGATGATCAACGAGATGATAATGGTCCTTTGAGTTGTCTTGAGAGCTTCGATTCGT
GCGTGAAGTGACGTATTAATACTGTACTACTACATGGTACATCATCGCTGTCTCTAACTTTTTACCCTTAGAGTCTAAGGGTACCCTAGATGCCATTTTA
TGCACAGGTTGAGCGGACGATGTAACATAATCAATGCAGTCTGTCCACTAGCGTACGCTCAGAGAAAGAACGCGCGACTTAACGTAATCCTAATGTGAAT
TCTCGTACATTGTCCCCGATCGGCGCTTTAAACGAGGGATTACCAGAGTGATTGTAGTTATTAAAATTCAGTAGTGCGTAAGGTTCCTAAACATGACCTG
GACCGGTTCCATGTCACCGAACCGACGTAGCATTAACTACATGTATTATGATCATGGTAGATTTTATACACCATGCGGGACCGAGCTCCCAAGTTCCACA
AAAAAAACGCGGGACTGTCCTGTTCTTTCTAAACTACCCCTTACCCCCCTCTCTATAAATTTTATATGTTTACATATAAAAGTATAAGAACTCGGAGCCC
GAGCACCAACGGAGAAATGTCAATGTAACCACAGCCCTTCTAGTTATTAAAATTTGGTTCCGAAAATTTTGGACCCAGGGTTCCCACAATTAATACATAT
AATTGCATTTCATTATAGAATTGAAGCACTACAGCAGCTCTACATGTAGTAAGTATGGCATCATTTTGGAACCGGTTCGGAACGCGGTTTTGGAACCTCG
GAACTGCACACCTACTCCGATTCAAATTTGACTTCCATCGCAAACTGCTGTATCTTGCACACGTTCTCATAGCTTGGCGCCATCATCCTCTTGCGTTTTG
AGTCCAGATACTTTTGATATTTGAAATCGGTGAATCTGTCAGGCGGAAGCACGAAGTACAGCCGCGGTGCTGCAGGATTTCCCAGGAGCTCCAACACATC
GTGGAGACCTTTTTGCTTGCAGGGGTGTTTGTGTGCACCTGTCACCTGCAACAAAATATCCGGCTTGATGATCGCATCGACCGACTGGTAATTTTTCACC
GCTGGCTGTAGGTAACTCGTGTTAGAAGCAGCTTCAATTTCACTGCCATGATTGAAAACAACAACTTTCTCGAGTCTCTGAAAAGAAATGACAGGTGCGG
CGCCACCGTCGACCAACGCCACAGCATTGGATTCGTCCATCGCAACGGCATCATCTTCATTCATGCCATCATCACCATCCTCGTCATCGCCGTCCCATTC
ATCTCCCATAAGGTCATCATCATCATCATCGTACGCCTCGTTGTTTTCGACCAAACGTCGAACTTGAAACGTTCCACCTCGCGGCAGCACTGAATGCACA
TGCCCTTCGAACAAGTGGCCACGAAAGAGCACCAACTCCATCCGAGGCAGCAATGAACTCTAGCAGCTTCCGCTTATCCTTCTTGTACAGCCGATTGTAC
ACCGCTTGCTGAACATATTGCGATGCAAAAGCGAAGTACTCGCTGTCAAAAGCTTTGCTAACGCGATAGTGCAGCAATCGATGCGACACTTGAGCGTCGT
TCGCATCAAGTTGACTACAGGCTTTCACCAACCAGTCGAGATCAACAGTGTCCGTTGCTTTTTCAAGCAACACCTGCTGGTCACCAACTTGTGAAAATCG
CAAGACATAGCGAGCAATACCACCCCATCGACGAAAGCAATCCTGCACGACGGCCATAGGTGTATCCGAGTACATCAGCTTACGACATTGTAGAATCTCC
TTCAAAGACCACACTGGCATGTAGCAGGACTGGCAATTGGTCTTGTTGAACTCGTACCAGATGGAGCGGCGCGGCGACGTCAAAAGAATCGTCTTCGCTG
GGTAATACGCAGGCTTGACGGCATCCACGATGTAGTATGTAGTCGGCTGGTCGAGAATGCGCACAAAATCTTCCTGAGATCCTTGAGCCACCACATTGTG
AGCAAATAAAAAGCGCTTCTTGAGGCCACCACTCTCATATACCACCGTTGCACCAGCACGGGCGAGAATAAGCACGATCACAAAGCCGAAAAACGTCTTG
CCGATTCCCGGGGTGCCGAGGATCACGAGATGCGGTGTGTTCGTCTTTTCATCTCGGATCCTCTCGAGACAAAGTTCCCATAGCGCAGGGTAGCAATGAC
GAATGTAGATACGAGAGCCGAGTGTCGAATCACCAAGAAGATACGTGTCTCGGGGTAACTCTACCAATGCGTCAGCTTTCACGTCGGTACTGTCATTCAG
AAATGCTTTCCAAAATGCGACCAGTGCTGGCGAATTCAACGACATACTTTGCGTGATTGGCATATGAACGTCGCCCAC